Научная статья на тему 'ЭКСПРЕССИЯ НУКЛЕАЗЫ CAS9 КОМПЛЕКСА CRISPR/CAS СИСТЕМЫ РЕДАКТИРОВАНИЯ ГЕНОМА В МИЦЕЛИАЛЬНОМ ГРИБЕ PENICILLIUM VERRUCULOSUM'

ЭКСПРЕССИЯ НУКЛЕАЗЫ CAS9 КОМПЛЕКСА CRISPR/CAS СИСТЕМЫ РЕДАКТИРОВАНИЯ ГЕНОМА В МИЦЕЛИАЛЬНОМ ГРИБЕ PENICILLIUM VERRUCULOSUM Текст научной статьи по специальности «Биологические науки»

CC BY
69
9
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
ГЕНОМНОЕ РЕДАКТИРОВАНИЕ / PENICILLIUM VERRUCULOSUM / GPDA ПРОМОТОР / GENOME EDITING / GPDA PROMOTER

Аннотация научной статьи по биологическим наукам, автор научной работы — Кислицин Валерий Юрьевич, Чулкин Андрей Михайлович, Синельников Игорь Геннадиевич, Синицын Аркадий Пантелеймонович, Рожкова Александра Михайловна

Ген cas9 бактерии Streptococcus pyogenes, кодирующий нуклеазу Cas9 системы CRISPR/Cas второго класса, был экспрессирован в мицелиальном грибе Penicillium verruculosum под контролем конститутивного аутологичного промотора гена gpdA глицеральдегид-3-фосфат-дегидрогеназы, который был впервые клонирован и секвенирован в представленной работе. Функциональность gpdA промотора была подтверждена экспрессией гетерологичного гена β-глюкозидазы Aspergillus niger в P. verruculosum. Относительное количество копий и уровень экспрессии гена cas9 в рекомбинантных штаммах был определен методом ПЦР в реальном времени. Для детекции и определения локализации нуклеазы Cas9 в клетках гриба P. verruculosum была получена химерная форма Cas9 и флюоресцентного белка eGFP, добавленного на С-конец нуклеазы. Флюоресцентная микроскопия растущего мицелия подтвердила внутриклеточную экспрессию химерной конструкции в клетках рекомбинантных штаммов.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по биологическим наукам , автор научной работы — Кислицин Валерий Юрьевич, Чулкин Андрей Михайлович, Синельников Игорь Геннадиевич, Синицын Аркадий Пантелеймонович, Рожкова Александра Михайловна

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

EXPRESSION OF CAS9 NUCLEASE OF CRISPR/CAS GENOME EDITING SYSTEM IN FILAMENTOUS FUNGI PENICILLIUM VERRUCULOSUM

The cas9 gene of the Streptococcus pyogenes bacterium, which encodes second-class CRISPR / Cas system Cas9 nuclease, was expressed in f lamentous fungus Penicillium verruculosum under the control of the constitutive autologous promoter of the gpdA gene encoding glyceraldehyde 3-phosphate dehydrogenase, which was cloned and sequenced at the f rst time in the this work. The functionality of the gpdA promoter was con f rmed by expression of the heterologous Aspergillus niger β -glucosidase in P. verruculosum. The relative copy number and expression level of the cas9 gene in recombinant strains was counted by real-time PCR. To detect the localization of Cas9 nuclease in P. verruculosum fungal cells a f uorescent eGFP protein was added to the C-terminus of Cas9 and the chimeric nuclease was expressed. Fluorescence microscopy of growing mycelium con f rmed the intracellular expression of the chimeric construct in cells of recombinant strains.

Текст научной работы на тему «ЭКСПРЕССИЯ НУКЛЕАЗЫ CAS9 КОМПЛЕКСА CRISPR/CAS СИСТЕМЫ РЕДАКТИРОВАНИЯ ГЕНОМА В МИЦЕЛИАЛЬНОМ ГРИБЕ PENICILLIUM VERRUCULOSUM»

УДК 577.29

ЭКСПРЕССИЯ НУКЛЕАЗЫ CAS9 КОМПЛЕКСА CRISPR/CAS СИСТЕМЫ РЕДАКТИРОВАНИЯ ГЕНОМА В МИЦЕЛИАЛЬНОМ ГРИБЕ

PENICILLIUM VERRUCULOSUM

В.Ю. Кислицин1, А.М. Чулкин1, И.Г. Синельников1, А.П. Синицын1'2, А.М. Рожкова1*

Федеральный исследовательский центр «Фундаментальные основы биотехнологии» Российской академии наук; 2 химический факультет Московского государственного университета имениМ.В. Ломоносова;*е-шаИ: amrojkova@mail.ru)

Ген cas9 бактерии Streptococcus pyogenes, кодирующий нуклеазу Cas9 системы CRISPR/Cas второго класса, был экспрессирован в мицелиальном грибе Penicillium verruculosum под контролем конститутивного аутологичного промотора гена gpdA глицеральдегид-3-фосфат-дегидрогеназы, который был впервые клонирован и секвенирован в представленной работе. Функциональность gpdA промотора была подтверждена экспрессией гетерологичного гена ß-глюкозидазы Aspergillus niger в P. verruculosum. Относительное количество копий и уровень экспрессии гена cas9 в рекомбинантных штаммах был определен методом ПЦР в реальном времени. Для детекции и определения локализации нуклеазы Cas9 в клетках гриба P. verruculosum была получена химерная форма Cas9 и флюоресцентного белка eGFP, добавленного на С-конец нуклеазы. Флюоресцентная микроскопия растущего мицелия подтвердила внутриклеточную экспрессию химерной конструкции в клетках рекомбинантных штаммов.

Ключевые слова: геномное редактирование, Pénicillium verruculosum, gpdA промотор.

В настоящее время методы геномного редактирования все шире используются в биотехнологии. Этот подход позволяет проводить нокаутирование определенных генов, удаление целых областей генома или замещение его участков донорными фрагментами ДНК [1, 2]. Метод геномного редактирования основан на использовании внутриклеточных механизмов репарации и рекомбинации геномной ДНК. Эффективно активировать данные процессы в необходимых участках генома можно, создавая в этих местах двуцепочечные разрывы геномной ДНК с помощью искусственных программируемых нуклеаз [3]. Одна из наиболее применяемых нуклеаз данного типа - белок Сая9 в комплексе с направляющей РНК ^КЫА). Широкое применение данного комплекса обусловлено большим удобством работы с ним по сравнению с программируемыми нуклеазами других типов [4]. Специфичность места гидролиза ДНК комплексом Са89^КЫА определяет последовательность 20-нуклеотидного участка направляющей РНК, называемого протоспейсером, который комплементарен редактируемому фрагменту генома. Таким образом, для получения специфического дву-цепочечного разрыва нуклеазой Сая9, нужно лишь доставить в клетку данный белок с направляющей

РНК длиной примерно 100 нуклеотидов или получить их in vivo.

Впервые редактирование генома мицелиаль-ного гриба с использованием нуклеазы Cas9 было проведено в 2015 г. [5]. Применение данного подхода существенно облегчает изучение функций генов, а также получение промышленных штаммов с улучшенными технологическими характеристиками [6]. В опубликованных материалах по редактированию геномов мицелиальных грибов белок Cas9 доставляют в клетку либо в виде комплекса с направляющей РНК [6], либо в виде гена. При редактировании с использованием собранного in vitro комплекса полученные клоны не содержат гена нуклеазы Сas9 и направляющей РНК, что, несомненно, можно считать преимуществом. Однако это требует дополнительных работ по синтезу и очистке компонентов комплекса. Доставка гена cas9 в редактируемую клетку может осуществляться без проведения указанных операций. В этом случае используют или автономно реплицирующиеся плазмиды [7] или интеграцию гена cas9 в геном [8]. Использование автономных плазмид с участком AMA1 Aspergillus nidulans, отвечающим за автономную репликацию плазмид, позволяет элиминировать гены системы CRISPR/

Cas. Возможность автономной репликации таких плазмид показана для грибов рода Aspergillus, а при изучении грибов рода Penicillium получены данные о встраивании фрагментов таких плазмид в геном [9]. Следовательно, использование плазмид с участком AMA1 у грибов из рода Penicillium представляется нецелесообразным.

Penicillium verruculosum (ВКМ F-3973D) секре-тирует высокоактивный сбалансированный комплекс целлюлаз [10], который используется для осахаривания растительных отходов, биополировки хлопчатых тканей, повышения питательности комбикормов и т.д. Адаптация технологии редактирования генома для данного вида может дать новый мощный инструмент для улучшения продуцируемых им ферментных комплексов.

Цель настоящей работы состояла в оценке возможности экспрессии гена cas9 Streptococcus pyogenes в мицелиальном грибе P. verruculosum и получении штаммов P. verruculosum с генотипом (cas9 ), что может стать этапом разработки методологической базы для редактирования генома гриба P. verruculosum с использованием системы CRISPR/Cas9.

Материалы и методы

Бактериальные и грибные штаммы и среды

Штаммы. В работе использовали штамм E. coli XL1-Blue (recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F' proAB lacIqZAM15 Tn10 (Tetr)]), реципиентный штамм P. verruculosum 537 (niaD ) [11].

Среды. Реципиентный и рекомбинантные штаммы P. verruculosum культивировались на минимальной среде (МС) с добавлением 10 мМ хлорида аммония или 10 мМ нитрата натрия в качестве источника азота. Состав среды МС (%): 50хРМ (2,0), раствор микроэлементов (0,1), глюкоза (1,0), а также 10 мМ NaNO3 или NH4Cl. Состав 50хРМ, (%): KH2PO4 (0,15), KCl (0,05), MgSO47H2O (0,05). Состав раствора микроэлементов (%): H3BO3 (0,005), CuSO4 5H2O (0,040), FeSO4 7H2O (0,080), MnSO4 2H2O (0,08), Na2MoO4 2H2O (0,080), ZnSO4 7H2O (0,080).

Состав ферментационной среды (ФС, %): KH2PO4 (1,50), (NH4)2SO4 (0,50), MgSO^O (0,03), CaCl2.2H2O (0,03), МКЦ (4,00), дрожжевой экстракт (1,00), пшеничные отруби (1,00).

Полученные после трансформации клоны пересевали на отдельные чашки Петри со средой МС для получения спор. Колбы со 100 мл ФС засевали 1х107 спор исследуемых штаммов. Рекомбинант-

ные штаммы культивировали 6 сут при 30 °С и 220 об/мин. На вторые - шестые сутки отбирали по 5 мл культуральной жидкости (КЖ), которую затем фракционировали путем центрифугирования (4000 об/мин) в течение 5 мин. Определение концентрации белка в супернатантах проходило по методу Лоури.

Определение ß-глюкозидазной активности

ß-Глюкозидазную активность определяли по гидролизу и-нитрофенил^-В-глюкопиранозида (пНФГ) концентрацией 1 мМ («Sigma», N-8016) до и-нитрофенола при 40 °С и рН 5,0. За единицу активности принимали такое количество фермента, которое способно катализировать образование 1 мкмоль продукта за 1 мин.

Клонирование промотора гена gpdA

Внутренний фрагмент гена gpdA P. verruculo-sum был клонирован и секвенирован нами ранее [12]. На полученную нуклеотидную последовательность были синтезированы два реверсных праймера PVGPDCR1 и PVGPDCR2 длиной 30 нуклеотидов. Протяженная 5'-фланкирующая область размером около 1600 п.н. была ампли-фицирована с использованием метода «ПЦР для неклонированной геномной ДНК» [13]. Последовательность секвенировали с помощью праймеров AP2, PVGPDCR2 и PVGPDSR1 (табл. 1). Анализ нуклеотидной последовательности выявил, что секвенированная часть гена gpdA P. verruculosum содержит 5 интронов в ко -дирующей части. Экзон-интронная структура части гена была определена путем сравнения нуклеотидной и аминокислотной последовательностей гена gpdA P. verruculosum с генами глицеральдегид-3-фосфат-дегидрогеназ других мицелиальных грибов с использованием правила GT-AG для начала и конца интронов. Таким образом, была получена неполная последовательность гена gpdA P. verruculosum, содержащая промотор этого гена длиной около 800 п.н. и 5'-фраг-мент его кодирующей части (рис. 1).

Создание конструкции для экспрессии

гена ß-глюкозидазы (bgl1) Aspergillus niger под контролем промотора гена gpdA P. verruculosum

Для проверки функциональности промотора gpdA P. verruculosum была разработана плазмид-ная конструкция, содержащая в себе ген bgl1 се-кретируемой ß-глюкозидазы Aspergillus niger (КФ 3.2.1.21) с собственным лидерным пептидом под контролем промотора гена gpdA P. verruculosum

Т а б л и ц а 1

Олигонуклеотиды, использованные в работе

Название Последовательность

GpdBg1R TCAAAGTGAACCTCATGATTGCGGTGATAGTTGC

GpdBg1D ATCACCGCAATCATGAGGTTCACTTTGATCGAGGC

Bg1KpnR CCCGTTGAGCACACTGATGGTCAAG

CasGFPSD1 CGACAGCTTCTTCCACAGACTG

CasGFPSD2 CAACCTGCTGGCCCAGATC

CasGFPSR1 GTCCACGATGTTGCCGAAG

PVGPDSR1 CCATGCCCATCTGTCCAAGAGA

PVGPDCR1 TGGCAGTGTAGGAGTGGATGGTGGTCATGA

PVGPDCR2 CGTGGTTGACACCCATGACGAACATCTAGA

AP2 ATAGGGCTCGAGCGGC

N1sCasD TCACCGCAATCATGCCAAAGAAGAAGCGGAAGGTCGGT

GpdBamD GATCAGGATCCGACTTCAGACCTGGATCGG

GpdNLSR TTCTTCTTTGGCATGATTGCGGTGATAGTTGC

CasApaR GGTCATCCAGGCGAATCTGCTG

prGpdSD GCTGCGTTACTTCTGGTGGAG

PVGPDQD2 AACGGCAAGCGCGTCAAGTTCT

PVGPDQR2 ACCCTTCAAGTGAGCAGAGGCCTT

PVACTQD1 ACAAGAAATCCAGACCGCTTCCC

PVACTQR1 TTTCGAGACCGATGACGGAAGG

в эквимолярном соотношении была использована в качестве матрицы для ПЦР с праймеров GpdBamD и BglKpnR. Полученный в результате амплификации ПЦР-фрагмент размером около 2 т.п.н. содержал в себе промотор гена gpdA и 5'-часть кодирующей области гена bgl1, фланкируемого сайтами рестрикции для ВатН\ и Крп\.

ПЦР-фрагмент был лигирован в плазмиду рРгСВН:^11, предварительно обработанную рестриктазами ВатН\ и Крп\. Полученная конструкция pGpdBg11 была секвенирована с использованием праймеров prGpdSD и Bg1KpnR (табл. 1) в обоих направлениях (рис. 2).

Создание конструкции для экспрессии химерного белка Сas9::eGFP

Для экспрессии химерного белка Cas9::eGFP была создана плазмидная конструкция, которая содержит ген оа$9-гО¥Р, кодирующий химеру Cas9::eGFP, фланкированный с Оконца сигналом внутриядерной локализации вируса SV40 и содержащий между Cas9 и eGFP сигнал внутриядерной

и с терминатором гена еЬН1 Р. уеггисы1о,?ит. Для этого был амплифицирован промотор гена gpdA с использованием праймера GpdBamD, содержащего внутри себя сайт рестрикции ВатН\, и прайме-ра GpdBg1R (табл. 1), обратно комплементарного 3'-концу промотора, с короткой нуклеотидной последовательностью на 5'-конце, обратно комплементарной началу кодирующей части сигнального пептида гена bgl1. В качестве матрицы использовали геномную ДНК Р. verruculosum. Был также амплифицирован 5'-фрагмент кодирующей части гена bgl1 с использованием праймера GpdBg1D, комплементарного началу кодирующей части сигнального пептида гена bgl1, с последовательностью на 5'-конце, комплементарной 3'-концу промотора gpdA, и праймера Bg1KpnR, обратно комплементарного 5'-кодирующей части гена bgl1, который расположен непосредственно после уникального сайта рестрикции Крп\. В качестве матрицы использовали ДНК плазмиды pPrCBH::bg11, полученной нами ранее [11]. Смесь этих ПЦР-фрагментов

1759 п.н.

Рис. 1. Структура секвенированной части гена gpdA Р. verruculosum

Рис. 2. Схема плазмиды pGpdBgl1. Указаны используемый сайт рестрикции и экзон-интронная структура гена

Рис. 3. Схема плазмиды pGpdCas9GFP. Указаны используемый сайт рестрикции и сигналы внутриядерной локализации (КЬ8)

локализации нуклеоплазмин Хвпорш laevis [14] под контролем промотора гена gpdA Р. verruculo-sum и с терминатором гена сЪН1 Р. verruculosum. Конструкция получена аналогично предыдущей.

Промотор гена gpdA был амплифицирован с помощью праймера GpdBamD, содержащего внутри себя сайт рестрикции БатН1, и праймера GpdNLSR (табл. 1), обратно комплементарного 3'-концу промотора, с дополнением на 5'-конце, обратно ком -плементарном началу кодирующей части сигнала внутриядерной локализации вируса SV40. В качестве матрицы использовали геномную ДНК Р. ver-ruculosum. Также был амплифицирован фрагмент, кодирующий сигнал внутриядерной локализации вируса SV40 и 5'-часть гена cas9, с использованием праймера NlsCasD (табл. 1), комплементарного началу сигнала внутриядерной локализации вируса SV40, с дополнением на 5'-конце, комплементарном З'-концу промотора gpdA, и праймера CasApaR, обратно комплементарного 5'- кодирующей части гена Ш59, которая расположена непосредственно после уникального сайта рестрикции Ара1. Смесь ПЦР-фрагментов в эквимолярном со-

отношении была использована в качестве матрицы для ПЦР с праймеров GpdBamD и CasApaR (табл. 1). Полученный в результате амплификации ПЦР-фрагмент размером около 1,4 т.п.н. содержал в себе промотор гена gpdA, сигнал внутриядерной локализации вируса SV40, и 5'-часть кодирующей области гена са$9, фланкируемый сайтами действия эндонуклеаз БатН1 и Ара1.

ПЦР-фрагмент был обработан рестриктазами БатН1 и Ара1 и встроен с помощью реакции ли-гирования вместо промотора гена сЪН1, сигнала внутриядерной локализации вируса SV40 и 5'-части кодирующей области гена са$9 в плазмиду pPrCBH::Cas9::GFP [неопубликованные данные], расщепленную эндонуклеазами БgЛI и Ара1. Полученная конструкция pGpdCas9GFP (рис. 3) была секвенирована с помощью праймеров CasGFPSR1, CasGFPSD1, CasGFPSD2 (табл. 1).

Трансформация штамма Р. verruculosum 537 и культивированиерекомбинантов

Целевыми плазмидами pGpdBgl1, pGpdCas-9GFP проводили трансформацию по методике

[15], используя котрансформационную плазмиду pSTA-10 [16], несущую селективный ген niaD ни-тратредуктазы Aspergillus niger.

Рекомбинантные штаммы высевали уколом на агаризованную среду ММ c 10 мМ нитратом натрия в качестве источника азота и инкубировали 14 дней при 32 °C. Споровой суспензией засевали 100 мл жидкой среды MM (5*106 спор/мл) с 10 мМ нитратом натрия и инкубировали 48 ч на орбитальной качалке (220 об/мин) при 32 °C, после чего из мицелия выделяли ДНК, используя набор DNeasy Plant Mini Kit («QIAGEN», США). РНК выделяли с помощью набора RNeasy Plant Mini Kit («QIAGEN», США).

Обратная транскрипция и ПЦР в реальном времени

Перед обратной транскрипцией по 1 мкг выделенной РНК обрабатывали ДНКазой I («Thermo-Scientific», США) в соответствии с инструкцией фирмы-производителя. Далее по 300 нг обработанной РНК использовали для синтеза кДНК набором RevertAid RT Reverse («ThermoScientific», США) с применением коммерческой смеси прай-меров oligoT и Random Hexamer Primers по 25 пкМ каждого на реакцию.

Пробы для ПЦР в реальном времени имели следующий состав: прямой праймер (10 пмоль), обратный праймер (10 пмоль), реакционная смесь для проведения ПЦР-РВ с красителем EVA Green (M-439, «Синтол», Россия) (8 мкл), ДНК (4 нг), деионизованная вода (до 20 мкл). Программа ПЦР в реальном времени включала три стадии: I стадия - 5 мин при 95 °С, II стадия - 15 с при 95 °С, 45 с при 60 °С, 39 циклов (с измерением флюоресценции после каждого цикла), III стадия - увеличение температуры от 75 до 95 °С с шагом 0,2 °С за 10 с для определения температуры плавления продуктов ПЦР.

Для осуществления количественной ПЦР гена cas9, а также референсных генов gpdA и

actA были использованы соответственно следующие пары праймеров (табл. 1):

CasGFPSD1-CasGFPSR1, PVGPDQD2-PVGPDQR2,

PVACTQD1-PVACTQR1.

Амплификацию проводили на приборе «CFX96» («Bio-Rad», США) в совместимых 96-лу-ночных белых низкопрофильных плашках. Для анализа результатов использовали ПО Bio-Rad CFX Manager v. 3.1.

Подготовка препаратов для микроскопии

В стерильные пробирки (2 мл) с 1 мл минимальной среды МС засевали по 10 мкл смыва спор с колоний выросших на чашках Петри с агаризо-ванной средой ММ. Споры проращивали в течение 20 ч при 32 °С. Перед нанесением на предметные стекла проросший мицелий концентрировали на дне пробирки центрифугированием 5 мин при 4000 об/мин; 900 мкл среды отбирали с верхней части пробирки. Из оставшихся 100 мкл отбирали 10 мкл и помещали на предметные стекла для приготовления препарата типа «раздавленная капля». Микроскопирование проводили на флуоресцентном микроскопе «Axioskop 40» («Zeiss», Германия) с использованием ртутной лампы.

Результаты и их обсуждение

Для экспрессии белка Cas9 в клетках P. verrucu-losum было решено использовать собственный конститутивный промотор (gpdA) глицеральдегид-3-фосфат дегидрогеназы. Аналогичная схема была использована при экспрессии Cas9 в грибах рода Aspergillus [7]. Промотор гена gpdA P. verruculo-sum был клонирован и секвенирован впервые.

Для подтверждения функциональности клонированного промотора гена gpdA P. verruculosum была разработана плазмида pGpdBgl1 (рис. 2). Ген bgll использовали в данном случае как рефе-ренсный ген, показывающий ранее стабильную интеграцию в геном P. verruculosum в случае как

Т а б л и ц а 2

Концентрация белка (СБ, мг/мл) и удельная активность р-глюкозидазы на 1 мл культуральной жидкости (*)

и на 1 мг общего секретируемого белка (**)

КЖ СБ ^^^^ 537 (К) BGL-4 BGL-5 BGL-15 BGL-16

4,4±0,12 5,9±0,26 2,95±0,07 7,2±0,66 6,0 ± 0,51

Активность по пНФГ, ед./мл* 0,36 ± 0,01 34±1,5 9,1±0,28 21,8±0,91 35±2,5

Активность по пНФГ, ед./мг** 0,082±0,004 5,7±0,29 3,1±0,17 3,02±0,40 5,74±0,898

О б о з н а ч е н и я: КЖ - культуральная жидкость.

индуцибельной, так и конститутивной экспрессии [17]. Плазмиду интегрировали в геном штамма Р. verruculosum 537 в результате котрансформации с селективной плазмидой р8ТЛ-10, несущей ген таБ нитратредуктазы А. niger. После культивирования трансформантов на среде ФС были измерены концентрация белка в культуральной жидкости и активность Р-глюкозидазы по пНФГ (табл. 2). Из результатов измерений следует, что новый промотор gpdA обеспечивает синтез Р-глюкозидазы на уровне, соответствующем конститутивной экспрессии [17] и достаточном для экспрессии белка Са89. Более того, относительно низкий биосинтез нуклеазы Са89 предположительно снизит уровень нецелевого расщепления геномной ДНК комплексом Са89^тЛ [18].

Для экспрессии гена cas9 в Р. \erruculo-8ит 537 была создана плазмидная конструкция рОраСа89СРР (рис. 3). Плазмидой рОраСа89СРР трансформировали реципиентный штамм P. ver-ruculosum 537. Полученные транформанты выращивали на минимальной среде с глюкозой в качестве источника углерода. Из мицелия выделяли ДНК и РНК, после чего анализировали относительное число копий гена cas9 в трансформантах

и уровень экспрессии гена cas9 при росте мицелия на глюкозе, используя метод ПЦР в реальном времени. В качестве референсных генов были выбраны гены gpdA и актина actA P. ver-ruculosum. По результатам измерения относительного числа копий гена cas9, встроившихся в геном, и относительного уровня транскрипции в рекомбинантных клонах было установлено, что из пяти проверенных клонов наибольшее число копий имеется в клонах 1, 2 и 3, тогда как в клонах 4 и 5 их примерно в 5 раз меньше. Уровень экспрессии также коррелирует с числом встроившихся копий (рис. 4, 5). Клон 1 был выбран для анализа с использованием флюоресцентной микроскопии.

На снимках мицелия, полученного с помощью флюоресцентной микроскопии, наблюдалась зеленая флюоресценция с усилением в точках, что может свидетельствовать о накоплении Са89::еОРР в ядрах (рис. 6). Ядерная локализация Са89 позволит осуществить траффик комплекса Cas9-sgRNA в протопласты P verruculosum в дальнейших экспериментах. Нами был также проведен эксперимент по трансформации плазмиды pGpdGFP, не содержащей ген сas9. В этом случае

Рис. 4. Относительное число копий гена cas9 в трансформантах (1-5) и в реципиентном

штамме (К)

Рис. 5. Относительный уровень транскрипции гена сas9 в трансформантах (1-5) и в реципи-

ентном штамме (К)

Рис. 6. Флюоресцентная микроскопия (А) и микроскопия в проходящем свете (Б) растущего

мицелия штамма 1

не наблюдалось флюоресценции, локализующейся в ядрах мицелия (данные не представлены).

Таким образом, применение методов генетической инженерии позволило получить химерную форму Cas9::eGFP, экспрессия которой в ядрах мицелия позволяет говорить о базовой экспрессии Cas9 нуклеазы, что является важным методологическим шагом при разработке системы редактирования генома гриба Pénicillium verruculosum. Полученный результат показывает потенциальную возможность доставки комплекса Cas9-sgRNA для специфического расщепления ДНК и делеции тар-гетных генов. Например, удаление гена cbhl, который кодирует основной фермент целлюлолити-ческого комплекса, секретируемого грибом P. verruculosum, c использованием системы CRISPR/

Са89 позволит получить новую серию реципи-ентных штаммов Р. verruculosum сЬЫ шаЭ, что даст возможность экспрессировать новые реком-бинантные белки без примесей целлобиогидро-лазы I. Другим направлением использования системы СК18РЯ/Саз9 может стать редактирование генома Р. verrrucuosum, позволяющее провести нокаут генов-активаторов транскрипции, которые отвечают за экспрессию отдельных групп генов, в ответ на используемый источник углерода, или гена-активатора протеиназ, что предположительно повысит уровень экспрессии целевых белков. Работа выполнена при частичной поддержке Российского фонда фундаментальных исследований (проект № 18-29-07070). Конфликта интересов нет.

СПИСОК ЛИТЕРАТУРЫ

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

1. Esvelt K.M., Wang H.H. II Molecular Systems Biology. 2013. Vol. 9. P. 641.

2. Tan W.S., Carlson D.F., Walton M.W., Fahrenkrug S.C., Hackett P.B. II Advances in Genetics. 2012 Vol. 80. P. 37.

3. Ruet P., Smih F., Jasin M. II Mol. Cell Biol. 1994. Vol. 14. P. 8096.

4. Sontheimer E. J., Barrangou R. II Human Gene Therapy. 2015. Vol. 26. P. 413.

5. Liu R., Ling C., Jiang Y., Zhou Z., Zou G. II Cell Discov. 2015. Vol.12. N 1. P. 15007.

6. Rantasalo A., Vitikainen M., Paasikallio T., Jäntti J., Landowski C. P., Mojzita D. II Scientific reports. 2019. Vol. 9. P. 5032.

7. Nodvig C.S., Nielsen J.B., Kogle M.E., Mortensen U.H. II PLOS One 2015. Vol. 10. N 7. P. e0133085.

8. ZhengX., Zheng P., Zhang K., Cairns T. C., Meyer V., Sun J., Ma Y. II ACS Synth. Biol. 2018. Vol. 8. N 7. P. 1568.

9. Pohl C., Kiel J.A.K.W., Driessen A.J.M., Bovenberg R.A.L., Nygard Y. II ACS Synth. Biol. 2016. Vol. 5. P. 754.

10. Morozova V. V., Gusakov A.V., Andrianov R.M., Pravil-nikov A.G, Osipov D.O., Sinitsyn A.P. II Biotechnol. J. 2010. Vol. 5. P. 871.

11. Пат. РФ № 2378372 от 10.01.2010.

12. Чулкин А.М., Кислицин В.Ю., Зоров И.Н., Синицын А.П., Рожкова А.М. // Биотехнология. 2019. Т. 35. № 5. С. 51.

13. Siebert P.D., ChenchikA., Kellogg D.E., Lukyanov K.A., Lukyanov S.A. // Nucleic Acids Res. 1995. Vol. 23. N 6. P. 1087.

14. Dingwall C., Robbins J., Dilworth S.M., Roberts B., Richardson W.D. // J. Cell Biology. 1988. Vol. 107. N 3. P. 841.

15. Осипов Д.О., Рожкова А.М., Матыс В.Ю. и др. // Катализ в промышленности. 2010. № 5. С. 63.

16. Unkles S.E., Campbell E.I., Punt P.J., Hawker K.L., Contreras R., Hawkins A.R., Van den Hondel C.A., Kinghorn J.R. // Gene. 1992. Vol. 111. N 2. P. 149.

17. Dotsenko G.S., GusakovA.V., Rozhkova A.M., Korotkova O.G., Sinitsyn A.P. // Process Biochemistry. 2015. Vol. 50. P. 1258.

18. Hsu P.D., Scott D.A., Weinstein J.A., Ran F.A., Konermann S., Agarwala V., Li Y., Fine E.J., Wu X., Shalem O., Cradick T.J., Marraffini L.A., Bao G., Zhang F. // Nat. Biotechnol. 2013. Vol. 31. P. 827.

Поступила в редакцию 10.01.2020 Получена после доработки 12.01.2020 Принята к публикации 20.01.2020

EXPRESSION OF CAS9 NUCLEASE OF CRISPR/CAS GENOME EDITING SYSTEM IN FILAMENTOUS FUNGI PENICILLIUM VERRUCULOSUM V.Yu. Kislitsin1, A.M. Chulkin1, I.G. Sinelnikov1, A.P. Sinitsyn1,2, A.M. Rozhkova1*

(1 Federal Research Centre "Fundamentals of Biotechnology", Russian Academy of Sciences; Department of Chemical Enzymology, Faculty of Chemistry, M.V. Lomonosov Moscow State University, Moscow, Russia; *e-mail: amrojkova@mail.ru)

The cas9 gene of the Streptococcus pyogenes bacterium, which encodes second-class CRISPR / Cas system Cas9 nuclease, was expressed in filamentous fungus Penicillium verruculosum under the control of the constitutive autologous promoter of the gpdA gene encoding glyceraldehyde 3-phosphate dehydrogenase, which was cloned and sequenced at the first time in the this work. The functionality of the gpdA promoter was confirmed by expression of the heterologous Aspergillus niger p-glucosidase in P. verruculosum. The relative copy number and expression level of the cas9 gene in recombinant strains was counted by real-time PCR. To detect the localization of Cas9 nuclease in P. verruculosum fungal cells a fluorescent eGFP protein was added to the C-terminus of Cas9 and the chimeric nuclease was expressed. Fluorescence microscopy of growing mycelium confirmed the intracellular expression of the chimeric construct in cells of recombinant strains.

Key words: genome editing, Penicillium verruculosum, gpdA promoter.

Сведения об авторах: Кислицин Валерий Юрьевич - мл. науч. сотр. лаборатории биотехнологии ферментов Федерального исследовательского центра «Фундаментальные основы биотехнологии» РАН, канд. хим. наук (kislitsin.val@gmail.com ); Чулкин Андрей Михайлович - науч. сотр. лаборатории биотехнологии ферментов Федерального исследовательского центра «Фундаментальные основы биотехнологии» РАН, канд. биол. наук (zcbm1@yаndex.ru); Синельников Игорь Геннадиевич - мл. науч. сотр., аспирант лаборатории биотехнологии ферментов Федерального исследовательского центра «Фундаментальные основы биотехнологии» РАН (sinelnikov.i@list.ru); Синицын Аркадий Пантелеймонович - зав. лаб. физико-химии ферментативной биотрансформации полимеров химического факультета МГУ имени М.В. Ломоносова, зав. лаб. биотехнологии ферментов Федерального исследовательского центра «Фундаментальные основы биотехнологии» РАН, докт. хим. наук, профессор (apsinitsyn@gmail.com ); Рожкова Александра Михайловна - ст. науч. сотр. лаборатории биотехнологии ферментов Федерального исследовательского центра «Фундаментальные основы биотехнологии» РАН, канд. хим. наук (amrojkova@yahoo.com).

i Надоели баннеры? Вы всегда можете отключить рекламу.