CC BY
14
Усвщомлення i пересторога - два принципи ycix мiжнародних нормативно-правових докумешив щодо бюбезпеки при використаннi ГМ-рослин. Принципова полемша навколо трансгенних органiзмiв корисна, оскшьки примушуе генних iнженерiв постiйно полшшувати конструкцп, посилювати контроль за наслщками i, таким способом, працюе на користь стратеги виживання людства в умовах с^мкого росту населення i виснаження бюресурав. Але сyспiльство сьогодш мае право робити вибiр -споживати оргашчну чи генетично трансформовану 1жу. Тому державi необхiдно обов'язково забезпечити маркування ГМ-продyктiв.
Список лггератури
1. Современные биотехнологии - вызов времени / Блюм Я., Борлауг Н., Суржик Л., Сиволап Ю. - К.: РА NOVA, 2002. - 102 с.
2. Глазко В.И. Генетически модифицированные организмы: от бактерий до человека. - К.: «КВ1Ц», 2002. - 210 с.
3. Димань Т.М., Барановський М.М., Б^вський Г.О. Екотрофолопя. Основи еколопчно безпечного харчування. - К.: Лiбра, 2006. - 304 с.
4. Колотовкина Я.Б., Наумкина Е.М., Чижова С.И. Методы идентификации и мониторинг трансгенных компонентов в продуктах питания // Докл. Рос. академии сельскохозяйстенных наук. - 2008. - № 5. - С. 44-47.
5. Реймерс Н.Ф. Экология: Теория, законы, правила, принципы и гипотезы. - М.: Россия молодая, 1994. - 366 с.
6. Рудишин С.Д. Основи бютехнологп рослин. - Вшниця: МП «ЗАПАЛ», 1998. -224 с.
7. Рудишин С.Д. Бюлопчна тдготовка майбутшх еколопв: теорiя i практика: монографiя. - Вшниця: ВМГО «Темпус», 2009. - 394 с.
8. Сорочинський Б.В. Еколопчш ризики вщ випуску й використання генетично модифшованих рослин // Физиология и биохимия культ. растений. - 2008. - Т. 40. - С. 3-14.
9. Плейотропные эффекты гена хитиназы из Serratia phymuthica в трансгенном картофеле / Шахбазов А.В., Яковлева Г.А., Родькина И.А., Картель Н.А. // Цитология и генетика. - 2008. - № 2. - С. 3-9.
EFFICIENT PLANTLET REGENERATION AND AGROBACTERIUM TRANSFORMATION OF FLAX BY CHIMERIC GFP-TUA6 GENE
E.N. SHYSHA1, A.I. YEMETS1, PhD; V I. KORKHOVYY1, PhD;
S I. SPIVAK1, E.V. GUZENKO2, PhD; V.A. LEMESH2, PhD;
N.A. KARTEL2, DrSci; YA.B. BLUME1, DrSci 1Institute of Food Biotechnology and Genomics, National Academy of Science of Ukraine Institute of Genetics and Cytology, National Academy of Science of Belarus
Introduction
Flax (Linum usitatissimum L.) is one of the perspective agricultural culture in Europe and in the Ukraine, particularly. One of the aims of flax selection is a creation of new varieties with improved agro-technical characteristics that include the higher wind-resistance. Cell wall plays an essential role in formation of mechanical flax resistance to wind. It is well known that cellulose microfibrils is the main mechanical element of the cell wall, and it is generally considered that cortical microtubules control the direction of cellulose microfibril deposition [1, 2]. Thus, elucidation the correlation between microtubules organization peculiarities and their role in cellulose microfibril arrangement helps to understand the wind resistance in flax plants
on cell and tissue levels.
During last decades in vitro cultivation of flax (L. usitatissimum) has been successfully elaborated. Protocols have been established for in vitro shoot regeneration [4, 5, 6] and also for Agrobacterium- mediated transformation [3, 7, 8, 11, 13, 15].
In the present study, we have attempted to develop an efficient system for high frequency shoot regeneration of several L. usitatissimum varieties with different wind-resistance zoned on territories of Belarus and Ukraine by exploiting six combination of plant regulators 6-benzylaminopurine (BAP) and a-naphtalene acetic acid (NAA), and addition of supplements in order to optimize Agrobacterium tumefaciens transformation procedure of them and selected transgenic lines expressing chimeric GFP-TUA6 gene that could allow viasualize microtubules in flax cells.
Objects and methods of investigation
Culture medium. During experiments, MS [14] medium supplemented with 200 mg/l myo-inositol, 250 mg/l MES was used. Addition of 6 variants of plant regulators concentrations of BAP (1-3 mg/l) and NAA (0,05 - 0,1 mg/l) plus 20 g/l sucrose were added into the medium to test the plantlets regeneration. For shoots and roots development the hormone free MS medium with 10 mg/l sucrose was used. All media were gelled with 0,8 agar and adjusted to pH 5,8.
Plant material. L. usitatissimum seeds were kindly provided by the Institute of Genetics and Cytology NAS of Belarus (genotypes 'Dashkovskiy', 'K-65', 'Niva') and by the Institute of Fibre Cultures of Ukrainian Agricultural Academy of Sciences (genotypes 'Vruchiy', 'Zorya 87', 'Rushnichek', 'Svitanok', 'Ukrainskiy 3', 'Tomskiy 16'). Seeds sterilization was performed as described before [4].
Shoot regeneration. Hypocotyl explants from well germinated 6-days-old seedlings were cuted of 3-5 mm long and immediately placed onto plantlet regeneration medium. Green vigorous shoots were separated and placed on medium for shoots and roots development. The cultures were maintained at 22-24°C under 16-h light and 8-h dark photoperiods.
Agrobacterium-mediated transformation. Transformation was performed using A.tumefaciens strain LBA4404 harbouring a binary vector pBI121/GFP-TUA6 carrying chimeric tubulin gene TUA6 from Arabidopsis thaliana fused with GFP reporter gene from Aequorea victoria driven under cauliflower mosaic virus 35S promoter and nptll gene as selectable marker gene conferring resistanse to kanamycin [17].
Agrobacterium was cultured overnight at 28°C in liquid LB medium [16] containing 50 mg/l kanamycin and 100 mg/l rifampicin. An overnight culture of A.tumefaciens was centrifuged at 4000 rpm for 15 min and then resuspended in liquid MS medium without sucrose and phytohormones. The OD600 of bacteria was to 0,3-0,5 before inoculation.
The hypocotyl explants were immersed into Agrobacterium inoculum for 60 min and then placed onto MS medium supplemented with 200 mg/l myo-inositol, 250 mg/l MES, 20 g/l sucrose for co-cultivation period during 1, 2 or 3 days. Then co-cultivated hypocotyls were transferred onto medium for plantlets regeneration supplemented with 100 mg/l kanamycin for further selection of transformants and 400 mg/l carbenicillin for bacteria elimination. Explants were sub-cultured every 3 weeks on fresh medium. Regenerating shoots were picked up after 67 weeks and placed onto medium for shoots and roots development supplemented with 10 mg/l kanamycin.
DNA isolation and PCR analysis. Total genomic DNA was isolated from kanamycin-resistant shoots and untransformed control plant using Plant DNA Iolation Kit (Sigma, Germany). The primers used for amplification of a 622 base pair fragment of nptII gene were: 5"-CCTGAATGAACTCCAGGACGAGCA-3', 5' -GCTCTAGATCCAGAGTCCCGCTCAGAAG-3' and for amplification of a 840 base pair fragment of nptII gene were: 5'-GAGGCTATTCGGCTATGACT-3', 5'- AATCTCGTGATGGCAGGTTG - 3'. Amplification was
carried out under the following conditions: 5 min at 94oC (initial denaturation); followed by 25 cycles of 30 s at 94°C (denaturation), 45 s at 65°C (annealing) and 40 s at 72°C (extension); and a final stage of 7 min at 72°C (final extension) for primers which used for amplification of a 622 base pair fragment of the nptH gene and 5 min at 94°C (initial denaturation); followed by 25 cycles of 30 s at 94°C (denaturation), 60 s at 60°C (annealing) and 40 s - 72°C (extension); and a final stage of 7 min at 72°C (final extension) for 840 base pairs fragment of the nptll gene.
Microtubule visualization. Incorporation of tubulin labeled by GFP into native microtubules into cells of transformed flax lines was studieds by confocal laser scanning microscopy LSM 510 META (Carl Zeiss, Germany).
Results and discussion
Optimum concentrations of plant regulators for effective shoots regeneration were determined using six different combinations of BAP and NAA concentrations. Plantlets regeneration was observed using all tested variants BAP and NAA concentrations (Fig. 1). More large in size formation of calli was observed on plantlets regeneration medium supplemented with 3 mg/l BAP and 0,05 or 0,1 mg/l NAA but they practically did not produced abundant shoots on such media. A higher shoot regeneration frequency was observed on the medium with 1-2 mg/l BAP and 0,05-0,1 mg/l NAA (Fig. 1). On such media all tested flax varieties produced up 10-15 shoots per explant.
Fig. 1. Effects of growth regulators on in vitro shoot regeneration from hypocotyls
explants of flax cultivar Ukrainskiy 3 after 5 weeks in culture: a - 1 mg/l BAP + 0,1 mg/l NAA; b - 2 mg/l BAP + 0,1 mg/l NAA; c - 3 BAP mg/l + 0,1 mg/l NAA; d - 1 BAP mg/l + 0,05 mg/l NAA; e - 2 BAP mg/l + NAA 0,05 mg/l; f - 3 BAP mg/l Mr/a + NAA 0,05 mg/l, Bar = 1cm
It was shown earlier that flax transformation characterizes sometimes with a formation «shoot escapes» [9, 12]. Taking into account this fact a two steps selection was used in our experiments. The flax transformants were selected during shoots regeneration phase on the
respective medium containing 100 mg/l kanamycin according [18], and then during shoots and roots development phase on the corresponding medium containing 10 mg/l kanamycin (Fig. 2). From data obtained we can conclude that cultivar Svitanok has the highest transformation efficiency then others cultivars.
Fig. 2. Two selection phases: a - shoots regeneration phase (hypocotyls of germplasm
'Tomskiy 16' subcultured for three weeks on 100 mg/l kanamycin, Bar = 1,3 cm; b - shoots and roots development phase (putative transgenic shoots during selective shoot
elongation (10 mg/l kanamycin), Bar = 0,7 cm
It was also found that optical density of Agrobacterium during transformation as well as co-cultivation time in our experiments were an important factors in increasing the transformation efficiency. The 0D600=0,4 of Agro-inoculum and 2 days of co-cultivation period were more suitable for flax transformation as compared to 0D600=0,3 or 0D600=0,5 and 1 or 3 days co-cultivation period because the transformation frequency in first case was more high for all tested genotypes. The 0D600=0,3 was enough low for successful integration of T-DNA into the plant cells but 0D600=0,5 was too high due to high level of Agrobacterium contamination. The same problem was observed when co-cultivation period was 1 or 3 days.
To confirm the transgenic nature of selected plants the molecular genetic analysis was carried out. The presence of transferred nptII gene in transgenic shoots was investigated by the PCR analysis using specific primers. As it was found the 621 and 840 bp length fragments of the nptII were amplified from most regenerated plants of all flax varieties used in our study
Also transgenic nature of obtained lines was confirmed by confocal laser scanning microscopy. It was found that exogenous GFP-labeled tubulin is capable to co-polymerize with endogenous cell tubulin and to participate in cortical microtubule network formation in transgenic flax cells. The obtained lines will used for further investigation of microtubule organization and cellulose deposition in flax cell wall for understanding the processes of mechanical resistance in flax plants.
(Fig. 3).
L 1 2 3 4 5 6 7 8 9 10 11
621 bp -
- 840 bp
Fig. 3. PCR analysis of transformed flax lines with a probe to nptll (the primes used for amplification of a 621 base pair fragment of the nptll and 840): 1 - purified water; 2 -non-transformed control line; 3 - plasmid pBI121; 4 - cv. Ukrainskiy 3 - line 5; 5 - cv. Svitanok - line 7; 6 - cv. Svitanok - line 12; 7 - plasmid pBI121; 8 - cv. Vruchiy - line 1; 9 - cv. Svitanok - line 8; 10 - cv. Svitanok - line 10; 11 - cv. Ukrainskiy 3 - line 3
Conclusions
0ur results have shown efficient plantlets regeneration of several L. usitatissimum cultivars with different wind-resistance. The highest shoot regeneration frequency was obtained from hypocotyls explants on MS medium containing 1-2 mg/l BAP and 0,05-0,1 mg/l NAA. Moreover, reported results show the successful Agrobacterium-mediated transformation of some flax cultivars by plasmid carrying chimeric GFP-TUA6 gene.
Acknowledgements. The work was performed under support of Fund of Fundamental Investigation of Ukraine, projects F14.4/023 (2007-2008) and F29.4/016 (2009-2010). The authors also wish to thank Dr. I. Komarnitskiy (Institute of Cell Biology and Genetic Engineering, National Academy of Sciences of Ukraine, Kiev) for the kind gift of nptII primers.
References
1. Baskin T.I. 0n the alignment of cellulose microfibrils by cortical microtubules: a review and a model // Protoplasma. - 2001. - V. 215. - P. 150-171.
2. Baskin T.I. Anisotropic expansion of the plant cell wall // Annu. Rev. Cell Dev. Biol. -2005. - V. 21. - P. 203-222.
3. Genetic transformation of flax (Linum usitatissimum L.) by Agrobacterium tumefaciens. Regeneration of transformed shoots via callus phase / Basiran N., Armitage P., Scott R.J., Draper J. // Plant Cell Repts. - 1987. - V. 6, № 5. - P. 396-399.
4. In vitro tissue culture establishment and regeneration capacity of fiber flax genotypes with different wind resistance / Bayer 0.A., Bayer G.Ya., Yemets A.I., Blume Ya.B. // Physiol. Biochem. Cult. Plants. - 2004. - V. 36, N 1. - P. 48-54.
5. Improwed flax regeneration from hypocotyls using thidiazuron as a cytokinin source / Bretagne B., Chupeau M.-C., Chupeau Y., Fouilloux G. // Plant Cell Reports. - 1994. - V. 14. - P. 120-124.
6. Shoots and embryo-like structures regenerated from cultured flax (Linum usitatissimum L.) hypocotyls segments / Dedicova B., Hricova A., Samaj J., 0bert B., Bobak A., Pretova A. // J. Plant Physiol. - 2000. - V. 157. - P. 327-334.
7. Dong J.Z., McHughen A. Patterns of transformation intensity on flax hypocotyls inoculated with Agrobacterium tumefaciens // Plant Cell Rep. - 1991. - V. 10. - P. 555-560.
8. Dong J.Z., McHugen A. An improved procedure for production of transgenic flax plants using Agrobacterium tumefaciens // Plant Sci. - 1993. - V. 88. - P. 61-71.
9. Jordan M., McHughen A. Transformed callus does not necessarily regenerate transformed shoots // Plant Cell Rep. - 1988. - V. 7. - P. 285-287.
10. Lane D.W. Influence of growth regulators on root and shoot initiation from flax meristem-tips and hypocotyls in vitro //Physiol. Plant. - 1979. - V. 45. - P. 260-264.
11. McHughen A. Agrobacterium-mediated gene transfer of chlorsulfuron resistance to commercial flax cultivars // Plant Cell Rep. - 1989. - V. 8. - P. 445-449.
12. McHughen A., Jordan M.C. Recovery of transgenic plants from "escape" shoots // Plant Cell Rep. - 1989. - V. 7. - P. 611-614.
13. High efficiency Agrobacterium-mediated gene transfer to flax / Mlynarova L., Beuer M., Nap J.-P., Pretova A. // Plant Cell Rep. - 1994. - V. 13. - P. 282-283.
14. Murashige T., Skoog F. A revised medium for rapid growth and bioassays with tobacco tissue cultures // Physiol. Plant. - 1962. - V. 15. - P. 473-497.
15. Transformation plants of flax / Polyakov A.V., Chikrizova O.F., Kalyaeva М.А., Zacharchenko N.C., Balochina N.V., Buryanova Z.I. // Physiol. Plant. - 1998. - V. 45, N 6. -P. 882-887.
16. Sambrook J., Fritsch EF., Maniatis T. Molecular Cloning. Book 1. - New York: Cold Spring Harbor Laboratory Press, 1989. - P. 630-631.
17. Ueda K., Matsuyma T., Hashimoto T. Visualisation of microtubules in living cells of transgenic Arabidopsis thaliana L. // Protoplasma. - 1999. - V. 206 - P. 201-206.
18. The development of transformation vectors based upon modified plant a-tubulin gene as a selectable marker / Yemets A., Radchuk V., Bayer O., Bayer G., Baird V., Blume Ya. // Cell. Biol. Int. - 2008. - V. 32, N 5. - P. 566-570.
РЕГЕНЕРАЦ1Я УКРАШСЬКИХ СОРТ1В КАРТОПЛ1 ТА IX ГЕНЕТИЧНА ТРАНСФОРМАЦ1Я СИНТЕТИЧНИМИ CR F-ГЕНАМИ
1 о
В.П. ЖУК ; Т.М. ОЛШНИК , кандидат сгльськогосподарських наук;
Я.Б. БЛЮМ1, доктор бюлог1чних наук; A.I. СМЕЦЬ1, кандидат бюлог1чних наук Институт харчово! бютехнологп та геномши, Нащональна академiя наук Украши, Кшв 1нститут картоплярства, Украшська академiя аграрних наук, Кшв
Вступ
Картопля (Solanum tuberosum L.) е одшею з основних продовольчих сшьськогосподарських культур, як вирощують в Укршш, i стшко займае перше мюце в овочевому ращош жшешв нашо1 краши. Одшею з основних задач селекцiонерiв на сьогодшшнш день е тдвищення споживчих якостей картоплi на фош повного виключення хiмiчних засобiв захисту рослин, використання еколопчно безпечних методiв та засобiв пригшчення бур'яшв i комах-шкщниюв, як забезпечують запоб^ання забруднення навколишнього середовища та врожаю картоплi токсичними речовинами. Найбшьш злiсними для картопш е комахи-шкiдники, якi можуть повшстю знищувати як наземну частину рослин, так i пiдземну, i призводити до повно'1 або значно'1 втрати врожаю данно'1 культури. Широко застосовують для боротьби з такими шкщниками ефективнi препарати на основi Bt-бшюв бактерii BасШus thuringiensis, якi е активними шсектицидними агентами [1, 7]. Перевагами бiопестицидiв на основi Bt-бшюв у порiвняннi з хiмiчними шсектицидами е вiдсутнiсть забруднених залишкiв, висока специфiчнiсть дii, що обумовлюе 1х нешкiдливiсть для нецiльових органiзмiв i вiдносно низька цiна [1, 2, 6].
Необхщно вiдмiтити, що протягом останшх десятилiть були успiшно розвинеш рiзнi прийоми культивування та регенерацп картоплi в умовах in vitro. Для ще'1 сiльськогосподарськоi культури достатньо добре розроблеш ефективнi методи переносу
