CC BY
6# Research Results in Pharmacology
Research Results in Pharmacology 8(4): 109-114
UDC: 577.218 DOI 10.3897/rrpharmacology. 8.90447
3 Research Article
Effect of recombinant Sox9 protein on the expression of cartilage-specific genes in human dermal fibroblasts cell culture
Mikhail S. Bozhokin1,2, Svetlana A. Bozhkova2, Julia V. Sopova3,4, Elena R. Mikhailova1, Daria V. Marchenko1, Mikhail G. Khotin1
1 Institute ofCytology of the Russian Academy of Science, 4 Tikhoretsky Prospect, St. Petersburg 194064 Russia
2 Vreden National Medical Research Centre of Traumatology and Orthopedics, 8 Baikova St., St. Petersburg, 195427 Russia
3 St. Petersburg State University, 7/9 Universitetskaya Emb., St. Petersburg 199034 Russia
4 Saint-Petersburg branch of Vavilov Institute of General Genetics, 7/9 Universitetskaya Emb., St. Petersburg, 199034 Russia Corresponding author: Mikhail S. Bozhokin (writeback@mail.ru)
Academic editor: Alexey Deykin ♦ Received 20 August 2022 ♦ Accepted 24 November 2022 ♦ Published 15 December 2022
Citation: Bozhokin MS, Bozhkova SA, Sopova JuV, Mikhailova ER, Marchenko DV, Khotin MG (2022) Effect of recombinant Sox9 protein on the expression of cartilage-specific genes in human dermal fibroblasts cell culture. Research Results in Pharmacology 8(4): 109-114. https://doi.org/10.3897/rrpharmacology.8.90447
Abstract
Introduction: Damage to the hyaline layer of large joints resulting from injuries or age-related changes restricts their mobility. The repair of these disorders is an actual issue in medicine. One of the promising therapies is the usage of cell engineering constructs based on a biodegradable scaffold and a modified cell culture. A frequently used method to modify the proliferation of cell culture for tissue engineering of hyaline cartilage, which makes it possible to introduce an experimental technique into clinical practice, is the application of recombinant proteins that affect chondrogenesis and lead to increase synthesis of extracellular matrix proteins. The goal of this work was to elucidate the effect of the key transcription factor in the chondrogenesis process - Sox9 protein - on the expression of genes responsible for chondrogenesis (Tgffi3, Sox9, Acan, Comp, Col2a1).
Materials and methods: Human dermal fibroblasts were used as a cell culture; recombinant Sox9 was added at each change of medium; the modification was carried out for 21 days, and difference in gene expression was determined by real-time PCR and -AACt method.
Results and discussion: To assess the effectiveness of fibroblast modification, we analyzed the changing of expression of genes responsible for chondrogenesis (Tgffi3, Sox9, Col2a1, Acan, Comp). We studied the direct effect of different concentrations of the recombinant Sox9 protein on the proliferation of dermal fibroblasts in the chondrogenic direction. We showed that the addition of the recombinant Sox9 protein in various concentration did not significantly change the expression of both the genes encoding proteins of the extracellular matrix of hyaline cartilage (Acan, Col2a1, Comp) and the genes encoding chondrogenesis inducers (Tgffi3, Sox9).
Conclusion: As a result of the experiments, it was shown that the recombinant Sox9 protein has practically no effect on chondrogenic differentiation and does not significantly change the expression of chondrogenesis genes.
Keywords
Sox9, chondrogenesis, fibroblasts, gene expression, recombinant proteinroloquinolones.
Copyright Bozhokin MSetal. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC-BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Introduction
The hyaline cartilage covers the surfaces of the epiphyses of the bones articulating in the joint. The movement of the joint is provided by the sliding of hyaline layers. This tissue consists of extracellular matrix proteins (the most important proteins are type 2 collagen and aggre-can), a large amount of water (more than 2/3 by weight) and a small number of differentiated cells (Komarraju et al. 2020). Hyaline cartilage has a limited ability for recovery, and its defects only increase over time and lead to further tissue degradation and dysfunction of the joint (Bozhokin et al. 2017). The factors which promote a start of articular surface damage are: age-related changes (Anderson and Loeser 2010; Lotz and Loeser 2012), excessive exercise (Flanigan et al. 2010), genetic predisposition (Zabello et al. 2015), overweight (Kulkarni et al. 2016), inflammatory diseases of the joints, defects of the ligamentous apparatus, as well as native avascular and less cellular hyaline cartilage structure (Komarraju et al. 2020; Kulyaba et al. 2020).
Tissue engineering is one of actively developed methods that allows in the long term to delay and ideally avoid the need for joint arthroplasty (Makris et al. 2015; Bozhokin et al. 2016; Jeuken et al. 2016). This area of science includes a developing and implantation of a tissue-engineering structure based on a biodegradable scaffolds, containing a modified cell culture in the damaged area of the articular surface (Lammi et al. 2018). It is noteworthy that the restoration of hyaline cartilage using a tissue engineering method suggests the possibility of allogeneic cell products usage, for example, dermal fibroblasts or mesenchymal stem cells (Bozhokin et al. 2022). The advantages of these cell cultures are their availability (cell culture can be obtained from a specialized cell bank), the possibility of reprogramming (Makris et al. 2015), and the non-immunogenicity (Zorina et al. 2010).
The most important transcription factor that activates extracellular matrix genes in proliferating chondrocytes is the Sox9 protein (Song and Park 2020). Sox9 binds DNA via highly conservative high mobility group (HMG) domain, which contains nuclear localization sequences (NLS) and the nuclear export sequences (NES) (Jo et al. 2014). Sox9 also has a self-dimerization domain and a transactivation domain at the C-terminus. Sox9 forms di-mers that recruit SoxD (Sox5/6) dimers to activate type 2 collagen gene (Col2a1) transcription via a conserved enhancer sequence within the first intron (Ikeda et al. 2004). Sox9 promotes Acan (aggrecan) and Comp (cartilage oligomeric matrix protein) expression in human chondrocytes (Zhang et al. 2015).
In recent years, in order to obtain a more effective replacement of a superficial cartilage defect, researchers have usually modified cell cultures, for example, by use of various recombinant proteins that affect chondrogenesis (Crecente-Campo et al. 2017; Wang et al. 2017; Bozhokin
et al. 2018; Cheng et al. 2018). However, we have not found any works studying the chondrogenic effect of this recombinant protein on the culture of fibroblasts or chondrocytes when added to a nutrient medium.
In this work, we studied the effect of the recombinant Sox9 protein on the induction of the expression of chondrogenesis genes in human dermal fibroblasts.
Materials and methods
Cell culture
The study was performed on a dermal fibroblasts cell culture of DF2 (DF2 cells were obtained from the shared research facility "Vertebrate Cell Culture Collection" supported by the Ministry of Science and Higher Education of the Russian Federation (Agreement №075-152021-683)). Cells were cultured until the third passage under standard conditions (37 °C, 5% CO2) in DMEM (Gibco, USA) supplemented with fetal bovine serum (10%; Gibco, USA) and a mixture of antibiotics penicillin (50000 units/ml) and streptomycin (50 ^g/ml) (Gibco, USA).
Cell modification
Fibroblasts were modified with using the recombinant Sox9 protein (Sigma, USA) at concentrations of 1, 5, and 20 ng/^l. Bovine serum albumin (BSA; Serva, Germany) was used as a control at concentrations of 2 and 20 ng/^l. Proteins were added at each change of a culture medium. Fibroblasts were incubated for 7, 14, and 21 days, then separated from the culture plastic using Try-ple Express Enzyme (Thermofisher, USA) and frozen at -80 °C.
Isolation of RNA and obtaining cDNA
Total RNA was isolated from cells using Extract RNA reagent (Evrogen, Russia). RNA was used in a reverse transcription reaction using a MMLV RT kit (Evrogen, Russia) and a T100 Thermal Cycler (BioRad, USA).
Selection of primers for RT-PCR
To assess the effectiveness of fibroblast modification, we analyzed the changing of expression of genes responsible for chondrogenesis (Tgffi3, Sox9, Col2a1, Acan, Comp) by real-time PCR (RT-PCR) (Table 1). Nucleotide sequences were taken from the Ensembl database (https:// www.ensembl.org/index.html). Primers were selected according to the general design parameters and capture of exon-exon regions to prevent amplification of genomic DNA. The specificity of the amplicon and primer pairs was checked with the BLAST alignment tools (https:// blast.ncbi.nlm.nih.gov/Blast.cgi).
Table 1. List of analyzed genes and primers used for real-time PCR
Gene
Forward primer
Reverse primer
Amplified region length, bp
Function and role
Gapdh 5'-atgttccaatatgattccacc
Acan 5'- ttcgggcagaagaaggac
Col2a1 5'- cattgcctatctggacgaa
Comp 5'- gtgactgtgcccaactca
Sox9 5'- catcttcaaggcgctgca
Tgfß3 5'- cagtggagaaaaatagaacca
5'- atggtggtgaagacgcca 179
5'- ttctgtagtctgcgtttgta 170
5'- cccacttaccggtatgttt 149
5'- tttggtcgtcgttcttctg 202
5'- tcgcttcaggtcagcctt 157
5'- agattcttgccaccgatata 160
housekeeping gene (catalyses the sixth step of glycolysis) participation in chondrogenesis, extracellular matrix protein participation in chondrogenesis, extracellular matrix protein participation in chondrogenesis, extracellular matrix protein participation in chondrogenesis, transcription factor participation in chondrogenesis, cytokine
RT-PCR
RT-PCR was performed using the qPCRmix-HS SYBR kit (Evrogen, Russia) and previously selected and synthesized primers (Table 1). The reaction was set up on a CFX96 Touch device (BioRad, USA) according to the following scheme: 1 cycle at 95 °C for 10 min, 40 cycles at 95 °C for 3 min, 58 °C for 20 s and 72 °C for 20 s.
Gene expression values were assessed in terms of fold induction relative to the untreated cell population (control) using method 2-AACt, which shows the amount of amplification product relative to the Gapdh housekeeping gene calibration sample (Livak and Schmittgen 2001).
Results and discussion
Total RNA was isolated from all obtained cell samples with concentration ranged from 2.6 ng/^l to 32.01 ng/^l. Reverse transcription of the isolated RNA was performed to obtain cDNA.
The optimal primer annealing temperature according to the results of preliminary experiments was 58 °C. At this temperature, there was no nonspecific binding of primers, and only one amplification product was noted on the gel electrophoregram.
After PCR optimization, a semi-quantitative polymerase chain reaction was performed. Data on the threshold cycle of each of the samples were obtained (Fig. 1). We did not find any substantial change in Tgfft3 and Sox9 expression independent of periods of observation or recombinant protein concentration. The expression of Col2a1, Acan and Comp slightly increased on 7th day independent of concentration of recombinant Sox9, but then it returned to basic level on 14th and 21st day (Fig. 2).
The key step for development of techniques for the replacement of hyaline cartilage defects using the method of cell engineering is the effective modification of cells (Shestovskaya et al. 2021). Many researchers develop tissue engineering constructs based on autologous mes-enchymal stem cells or chondrocytes, which greatly complicates and increases the cost of preclinical research and clinical application of this method (Tsumaki 2013; Tam et al. 2014; NCT02291926; NCT01050816). Fibroblasts, in our opinion, are some of the promising sources for cell engineering of hyaline cartilage, since this culture can
Figure 1. Amplification plot showing PCR profiles
Figure 2. Changes in relative expression of Tgfß3, Sox9, Col2a1, Acan, and Comp genes in human dermal fibroblasts calculated by the 2-AACt method at different concentrations of the recombinant Sox9 protein.
be easily and minimally invasively isolated, non-immu-nogenic, and subject to modification for the formation of articular cartilage regenerate, which was shown in (Yu et
al. 2022). For cell modification, we used the recombinant Sox9 protein, which is the most important transcription factor for chondrogenesis (Song and Park 2020). Tam et al. (2014) reported positive results using Sox9-modified (viral transduction) fibroblasts to repair both bone and, to a lesser extent, hyaline cartilage. We studied the direct effect of different concentrations of the recombinant protein on the proliferation of dermal fibroblasts in the chon-drogenic direction. As a result, we showed that the addition of the recombinant Sox9 protein in the concentration range from 1 to 20 ng/ml of the nutrient medium did not significantly change the expression of both the genes encoding proteins of the extracellular matrix of hyaline cartilage (Acan, Col2a1, Comp) and the genes encoding chondrogenesis inducers.
The results obtained by Zhang et al. (2017) show that a modified SOX9, fused with supercharged GFP (scSOX9) has the capability of entering cells and inducing MSC to differentiate into chondrocytes in vitro. The absence of chondrogenic differentiation in our experiments can be explained by the fact that the recombinant Sox9 protein
References
■ Bozhokin MS, Bozhkova SA, Netylko GI (2016) Possibilities of current cellular technologies for articular cartilage repair (analytical review). Traumatology and Orthopedics of Russia [Travmatologiya i Ortopediya Rossii] 22(3): 122-134. https://doi.org/10.21823/2311-2905-2016-22-3-122-134 [in Russian]
■ Bozhokin MS, Bozhkova SA, Netylko GI, Nakonechnyj DG, Blino-va MI, Nashchekina YA (2018) Experimental results of rat hyaline cartilage surface defect replacement with a cell engineering structure. Proceedings of the Karelian Research Centre of the Russian Academy of Sciences [Trudy Karel'skogo Nauchnogo Tsentra RAN] 4: 13-22. https://doi.org/10.17076/them815 [in Russian]
■ Bozhokin MS, Bozhkova SA, Netylko GI, Rumakin VP, Na-konechnyy DG, Chepurnenko MN (2017) Morphofunctional characteristics of chondroregenerative process in experimental local superficial defect of articular cartilage. International Journal of Applied and Fundamental Research [Mezhdunarodnyy Zhurnal Prikladnykh i Fundamental'nykh Issledovanii] 8: 302-306. [in Russian]
■ Bozhokin MS, Marchenko DM, Mikhailova ER, Antipov AP, Nashchekina YA, Vcherashnij DB, Novoseltsev SV, Kruglov VN (2022) Primary results of replacement the experimental hyaline cartilage defect with human fibroblast cell culture. Bulletin of the Medical Institute "REAVIZ": Rehabilitation, Doctor and Health [Vestnik Med-itsinskogo Instituta "REAVIZ": Reabilitatsiya, Vrach i Zdorov'e] 12(2): 14-21. https://doi.org/10.20340/vmi-rvz.2022.2.M0RPH.1 [in Russian]
■ Cheng A, Cain SA, Tian P, Baldwin AK, Uppanan P, Kielty CM, Kimber SJ (2018) Recombinant extracellular matrix protein fragments support human embryonic stem cell chondrogenesis. Tissue Engineering 24(11-12): 968-978. https://doi.org/10.1089/ten. TEA.2017.0285 [PubMed] [PMC]
■ ClinicalTrials.gov Bethesda (MD): National Library of Medicine (US). 2000 Feb 29. Identifier NCT02291926, Human Umbilical Cord
without modifications is not able to penetrate into the cell and trigger the induction of chondrogenesis.
Conclusion
Thus, the direct effect of the recombinant Sox9 protein on the expression of genes associated with chondrogenic differentiation in the culture of dermal fibroblasts is insignificant and is not suitable as a tool for activating directed differentiation.
Acknowledgments
The RT-PCR experiments were performed at the Center for Molecular and Cell Technologies of Research park of St.Petersburg State University.
This work was supported St.Petersburg State University grants for the development of scientific research (ID 92561695 and ID 93025998).
Mesenchymal Stem Cell Transplantation in Articular Cartilage Defect, November 17, 2014. https://clinicaltrials.gov/ct2/show/study/ NCT02291926
■ ClinicalTrials.gov Bethesda (MD): National Library of Medicine (US). 2000 Feb 29. Identifier NCT01050816, Effects of CHONDRON (Autologous Chondrocytes) With Ankle Cartilage Defect, January 15, 2010. https://clinicaltrials.gov/ct2/show/study/NCT01050816
■ Crecente-Campo J, Borrajo E, Vidal A, Garcia-Fuentes M (2017) New scaffolds encapsulating TGF-ß3/BMP-7 combinations driving strong chondrogenic differentiation. European Journal of Pharmaceutics and Biopharmaceutics 114: 69-78. https://doi.org/10.1016/j. ejpb.2016.12.021 [PubMed]
■ Flanigan DC, Harris JD, Trinh TQ, Siston RA, Brophy RH (2010) Prevalence of chondral defects in athletes' knees: a systematic review. Medicine and Science in Sports and Exercise 42(10): 17951801. https://doi.org/10.1249/MSS.0b013e3181d9eea0 [PubMed]
■ Ikeda T, Kamekura S, Mabuchi A, Kou I, Seki S, Takato T, Nakamu-ra K, Kawaguchi H, Ikegawa S, Chung UI (2004) The combination of SOX5, SOX6, and SOX9 (the SOX trio) provides signals sufficient for induction of permanent cartilage. Arthritis and Rheumatism 50(11): 3561-3573. https://doi.org/10.1002/art.20611 [PubMed]
■ Jeuken R, Roth A, Peters R, van Donkelaar C, Thies J, van Rhijn L, Emans PJ (2016) Polymers in cartilage defect repair of the knee: current status and future prospects. Polymers 8(6): 219. https://doi. org/10.3390/polym8060219 [PubMed] [PMC]
■ Jo A, Denduluri S, Zhang B, Wang Z, Yin L, Yan Z, Kang R, Shi LL, Mok J, Lee MJ, Haydon RC (2014) The versatile functions of Sox9 in development, stem cells, and human diseases. Genes and Diseases 1(2): 149-161. https://doi.org/10.1016/j.gendis.2014.09.004 [PubMed] [PMC]
■ Komarraju A, Goldberg-Stein S, Pederson R, McCrum C, Chhabra A (2020) Spectrum of common and uncommon causes of knee joint
hyaline cartilage degeneration and their key imaging features. European Journal of Radiology 129: 109097. https://doi.org/10.1016/j. ejrad.2020.109097 [PubMed]
■ Kulkarni K, Karssiens T, Kumar V, Pandit H (2016) Obesity and osteoarthritis. Maturitas 89: 22-28. https://doi.org/10.1016/j.maturi-tas.2016.04.006 [PubMed]
■ Kulyaba TA, Bantser SA, Trachuk PA, Vorontsova TN, Kornilov NN (2020) The effectiveness of various surgical techniques in the treatment of local knee cartilage lesions (review). Traumatology and Orthopedics of Russia [Travmatologiya i Ortopediya Rossii] 26(3): 170-181. https://doi.org/10.21823/2311-2905-2020-26-3-170-181 [in Russian]
■ Lammi MJ, Piltti J, Prittinen J, Qu C (2018) Challenges in fabrication of tissue-engineered cartilage with correct cellular colonization and extracellular matrix assembly. International Journal of Molecular Sciences 19(9): 2700. https://doi.org/10.3390/ijms19092700 [PubMed] [PMC]
■ Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25(4): 402-408. https://doi.org/10.1006/ meth.2001.1262 [PubMed]
■ Lotz M, Loeser RF (2012) Effects of aging on articular cartilage homeostasis. Bone 51(2): 241-248. https://doi.org/10.1016/j. bone.2012.03.023 [PubMed] [PMC]
■ Makris EA, Gomoll AH, Malizos KN, Hu JC, Athanasiou KA (2015) Repair and tissue engineering techniques for articular cartilage. Nature Reviews Rheumatology 11(1): 21-34. https://doi.org/10.1038/ nrrheum.2014.157 [PubMed] [PMC]
■ Shane Anderson A, Loeser RF (2010) Why is osteoarthritis an age-related disease? Best Practice and Research: Clinical Rheumatology 24(1): 15-26. https://doi.org/10.1016/j.berh.2009.08.006 [PubMed] [PMC]
■ Shestovskaya MV, Bozhkova SA, Sopova JV, Khotin MG, Bozhokin MS (2021) Methods of modification of mesenchymal stem cells and conditions of their culturing for hyaline cartilage tissue engineering. Biomedicines 9(11): 1666. https://doi.org/10.3390/biomedi-cines9111666 [PubMed] [PMC]
■ Song H, Park KH (2020) Regulation and function of SOX9 during cartilage development and regeneration. Seminars in Cancer Biology 67(Pt 1): 12-23. https://doi.org/10.1016/j.semcancer.2020.04.008 [PubMed]
■ Tam WL, O DF, Hiramatsu K, Tsumaki N, Luyten FP, Roberts SJ (2014) Sox9 reprogrammed dermal fibroblasts undergo hypertrophic differentiation in vitro and trigger endochondral ossification in vivo. Cellular Reprograming (Formerly "Cloning and Stem Cells") 16(1): 29-39. https://doi.org/10.1089/cell.2013.0060 [PubMed] [PMC]
■ Tsumaki N (2013) Cartilage regeneration using cell reprogramming technologies. Clinical Calcium 23(11): 1641-1648. [PubMed]
■ Wang J, Sun B, Tian L, He X, Gao Q, Wu T, Ramakrishna S, Zheng J, Mo X (2017) Evaluation of the potential of rhTGF-p3 encapsulated P(LLA-CL)/collagen nanofibers for tracheal cartilage regeneration using mesenchymal stems cells derived from Wharton's jelly of human umbilical cord. Materials Science and Engineering C: Materials for Biological Applications 70(Pt 1): 637-645. https://doi. org/10.1016/j.msec.2016.09.044 [PubMed]
■ Yu L, Lin YL, Yan M, Li T, Wu EY, Zimmel K, Qureshi O, Falck A, Sherman KM, Huggins SS, Hurtado DO, Suva LJ, Gaddy D, Cai J, Brunauer R, Dawson LA, Muneoka K (2022) Hyaline cartilage differentiation of fibroblasts in regeneration and regenerative medicine. Development (Cambridge, England) 149(2): dev200249. https://doi.org/10.1242/dev.200249 [PubMed] [PMC]
■ Zabello TV, Miromanov AM, Miromanova NA (2015) Genetic aspects of development of an osteoarthrosis Fundamental Research [Fundamental'nye Issledovaniya] 1(Part 9): 19701976. [in Russian]
■ Zhang Q, Ji Q, Wang X, Kang L, Fu Y, Yin Y, Li Z, Liu Y, Xu X, Wang Y (2015) SOX9 is a regulator of ADAMTSs-induced cartilage degeneration at the early stage of human osteoarthritis. Os-teoarthritis Cartilage 23(12): 2259-2268. https://doi.org/10.1016/j. joca.2015.06.014 [PubMed]
■ Zhang X, Wu S, Naccarato T, Prakash-Damani M, Chou Y, Chu CQ, Zhu Y (2017) Regeneration of hyaline-like cartilage in situ with SOX9 stimulation of bone marrow-derived mesenchymal stem cells. PLOS ONE 12(6): e0180138. https://doi.org/10.1371/journal. pone.0180138 [PubMed] [PMC]
■ Zorina AI, Zorin VL, Cherkasov VR (2010) Cellular technologies in aesthetic medicine. Modern Problems of Dermatovenereology, Immunology and Medical Cosmetology [Sovremennye Problemy Dermatovenerologic Immunologii i Vrachebnoi Kosmetologii] 4(4): 76-82. [in Russian]
Author contributions
■ Mikhail S. Bozhokin, assistant researcher, Vreden National Medical Research Center for Traumatology and Orthopedics; e-mail: writeback@mail.ru, ORCID ID https://orcid.org/0000-0002-9931-3394. The author conducted the experimental work, analyzed the results, wrote and edited the text of the article.
■ Svetlana A. Bozhkova, Dr. Habil. Sci. (Med.), Head of the Research Department of Prevention and Treatment of Wound Infection and Department of Clinical Pharmacology, Vreden National Medical Research Center for Traumatology and Orthopedics; e-mail: clinpharm-rniito@yandex.ru, ORCID ID https://orcid.org/0000-0002-2083-2424. The author advised on the research idea and edited the text of the article.
■ Julia V. Sopova, PhD in Biology, leading researcher, Center of Tansgenesic and Genome Editing, Institute of Translational Biomedicine, St. Petersburg State University; e-mail: y.sopova@spbu.ru, ORCID ID https://orcid. org/0000-0002-7825-273X. The author defined the idea of research, analyzed the material, results and conclusions, edited the text of the article and image visualization.
■ Elena R. Mikhailova, PhD in Biology, researcher, Laboratory of Cell Protection Mechanisms, Institute of Cytology of the Russian Academy of Sciences; e-mail: mikhailovaer@yandex.ru, ORCID ID https://orcid.org/0000-0001-8576-3717. The author conducted the experimental work and analyzed the results.
■ Daria V. Marchenko, researcher, Laboratory of Cell Protection Mechanisms, Institute of Cytology of the Russian Academy of Sciences; e-mail: berbimot@yandex.ru, ORCID ID https://orcid.org/0000-0002-7940-9444. The author conducted the experimental work and analyzed the results.
■ Mikhail G. Khotin, PhD in Biology, Head of the Laboratory of Biomedical Technologies and Testing with Pilot Production, Cell Technologies Center, Institute of Cytology of the Russian Academy of Sciences; e-mail: h_mg@ mail.ru, ORCID ID https://orcid.org/0000-0002-8293-6368. The author defined the research idea, the concept and design of the study.
