CC BY
36Physics of the Alive, Vol. 18, No 2, 2010. C.110-120.
© Minchenko D.O., Karbovsky L.L., Terletsky B.M., Hubenya O. V., Moenner M., Minchenko O.G.
Physics of the Alive
UDC 577.112.7:616
EFFECT OF HYPOXIA, GLUTAMINE AND GLUCOSE DEPRIVATION ON THE EXPRESSION OF CYCLIN B1, B2, C, G1, H, I, T2 AND SOME CYCLIN-DEPENDENT
GENES IN GLIOMA CELLS
1,2,3Minchenko D.O., xKarbovsky L.L., xTerletsky B.M., xHubenya O. V., 3Moenner M., 1,3Minchenko O.H.
1Palladin Institute of Biochemistry National Academy of Science of Ukraine, Kyiv, Ukraine;
2National O.O. Bohomoletz Medical University, Kyiv, Ukraine;
3INSERM U920 Molecular Mechanisms of Angiogenesis Laboratory, University Bordeaux 1, Talence, France;
e-mail: [email protected]
Was accepted 28.03.2010
A set of complex intracellular signaling events known as the unfolded protein response, mediated predominantly by endoplasmic reticulum - nuclei-1 sensing enzyme, is induced in cancer cells via hypoxia and ischemia and is necessary for neovascularization and proliferation processes. A lot of cyclins, cyclin-dependent kinases and its inhibitors, retinoblastoma proteins and E2F transcription factors are the components of endoplasmic reticulum stress system as well as participate in the control of cell cycle and proliferation processes. We have studied the effect of hypoxia and ischemic conditions (glucose or glutamine deprivation) on the expression of genes which are participate in the control of cell cycle and proliferation in glioma cell line U87 and its endoplasmic reticulum -nuclei-1-deficient subline. It was shown that blockade of endoplasmic reticulum - nuclei signaling enzyme-1, the key endoplasmic reticulum stress sensor, leads to decrease the expression levels of cyclin B1, B2, C, G1 and T2 mRNAs. However, the expression levels of cyclin I and calcyclin binding protein mRNA as well as cell division cycle-2 (cyclin-dependent kinase-1) and transcription factor DMTF mRNAs are increased in endoplasmic reticulum - nuclei-1-deficient glioma cells. Moreover, we have shown that mRNA expression levels of most studied genes are also decreased under hypoxic and glucose or glutamine deprivation conditions both in control and endoplasmic reticulum - nuclei-1-deficient glioma cells, but expression levels of cyclin G1 and I as well as cyclin-dependent kinase inhibitor-1A are increased at these conditions. Thus, results of this study clearly demonstrated that the expression levels of most tested genes encoded cyclins and cyclin-dependent genes is dependent from endoplasmic reticulum -nuclei-1 signaling enzyme function both in normal, hypoxic and ischemic conditions and possibly participate in cell adaptive response to endoplasmic reticulum stress associated with these factors.
Key words: mRNA expression, cyclin B1, B2, C, G1, H, I and T2, cell division cycle-2, glioma cells, endoplasmic reticulum -nuclei-1, hypoxia, glucose or glutamine deprivation.
INTRODUCTION
Hypoxia and ischemia have been shown to induce a set of complex intracellular signaling events known as the unfolded protein response, which is mediated by endoplasmic reticulum - nuclei-1 signaling enzyme (also named by inositol requiring enzyme-1 alpha), to adapt cells for survival or, alternatively, to enter cell death programs through endoplasmic reticulum-associated machineries [1-5]. As such, it participates in the early cellular response to the accumulation of misfolded proteins in the lumen of the endoplasmic reticulum, occurring under both physiological and pathological situations.
Two distinct catalytic domains of the bifunctional signaling enzyme endoplasmic reticulum - nuclei-1 were identified: a serine/threonine kinase and an
endoribonuclease which contribute to endoplasmic reticulum - nuclei-1 signalling. The endoplasmic reticulum - nuclei-1-associated kinase activity autophosphorylates and dimerizes this enzyme, leading to the activation of its endoribonuclease domain, to the degradation of a specific subset of mRNA and to the
initiation of the pre-XBP1 (X-box binding protein 1) mRNA splicing [6-9]. Mature XBP1 mRNA splice variant encodes a transcription factor that has different C-terminus amino acid sequence and stimulates the expression of hundreds of unfolded protein response-specific genes [3, 10-12]. Recently was shown that endoribonuclease domain of endoplasmic reticulum -nuclei-1 signaling enzyme can be activated by kinase inhibitor to confer cytoprotection against endoplasmic reticulum stress [13].
Greenman at al. [14] recently shown that single mutations in endoplasmic reticulum - nuclei-1 gene were detected in different human cancers and encoded by this gene enzyme was proposed as a major contributor to tumor progression among protein kinases, including glioblastoma, the most frequent primary brain neoplasms. The endoplasmic reticulum - nuclei-1 signal transduction pathway is linked to the neovascularization process, tumor growth and cellular death processes because the complete blockade of this sensing enzyme activity had clear antitumor effects [15-17]. Recent data shown that endoplasmic reticulum stress response-signalling pathway
is involved in osteoblast differentiation and participates in apoptosis induction by different agents, in particular, by N-acetyl cysteine and penicillamine [18, 19]. Thus, the growing tumor requires the endoplasmic reticulum stress for own neovascularization and growth.
It has been known that cyclins, cyclin-related proteins, cyclin-dependent kinases and its inhibitors, retinoblastoma proteins and E2F transcription factors participate in the control of cell cycle and proliferation as well as are the components of endoplasmic reticulum stress [20-22]. The cyclin family, whose members are characterized by a dramatic periodicity in protein abundance throughout the cell cycle, are highly conserved. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclins consist of 8 classes of cell cycle regulators that share a conserved amino acid sequence of about 90 residues called the cyclin box and regulate cyclin dependent kinases (CDK). Cyclins B1, B2, C, G1, H, I and T2 as well as a big family cyclin-dependent genes play an important role in the control of malignant tumor growth, including glioblastoma (Glioblastoma multiforme) which is the most common primary brain tumor [20, 22 - 25]. The rapid growth of these solid tumors generates microenvironmental changes in association to hypoxia, nutrient deprivation and acidosis. Under those ischemic conditions, tumor cells trigger an adaptive response and modulate the pro/anti-angiogenic balance to initiate the formation and attraction of new blood vessels to the tumor.
Cyclin B1 (CCNB1) and cyclin B2 (CCNB2) are members of the cyclin family, specifically the B-type cyclins. The B-type cyclins associate with cell division cycle-2 (cyclin-dependent kinase-1, p34) and are essential components of the cell cycle regulatory machinery because this complex forms the maturation-promoting factor [23, 25]. Cyclins B1 and B2 differ in their subcellular localization: cyclin B1 co-localizes with microtubules, whereas cyclin B2 is primarily associated with the Golgi region. There is data that cyclin B1/cyclin-dependent kinase-1 phosphorylation of mitochondrial p53 induces anti-apoptotic response [23]. Moreover, cyclin B 1/cyclin-dependent kinase-1 complex controls Fas-mediated apoptosis by regulating caspase-8 activity [26]. Two alternative transcripts of cyclin B1 have been identified, a constitutively expressed transcript and a cell cycle-regulated transcript that is expressed predominantly during G2/M phase. Cyclin B2 also binds to transforming growth factor beta receptor-II and thus cyclin B2/cell division cycle-2 may play a key role in transforming growth factor beta-mediated cell cycle control. It was also shown that cyclin-dependent kinase-5 activation in cells that overexpressed cyclin G1 leads to c-Myc phosphorylation on Ser-62, which is responsible for cyclin G1-mediated transcriptional activation of cyclin B1 [27].
The protein encoded by cell division cycle-2 (cyclin-dependent kinase-1) gene is a member of the Ser/Thr protein kinase family [22, 24]. It is a catalytic subunit of
the highly conserved protein kinase complex known as M-phase promoting factor, which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with this protein and function as regulatory subunits. The kinase activity of cell division cycle-2 protein is controlled by cyclin accumulation and destruction through the cell cycle. Moreover, cyclin-dependent kinase-1 phosphorylates p62, which is necessary for the maintenance of appropriate cyclin B1 levels [24]. The phosphorylation and dephosphorylation of this protein also play important regulatory roles in cell cycle control.
The protein encoded by cyclin C (CCNC) gene interacts with cyclin-dependent kinase 8 and induces the phosphorylation of the carboxy-terminal domain of the large subunit of RNA polymerase II. The level of mRNAs for this gene peaks in the G1 phase of the cell cycle. It was shown that cyclin C regulates human hematopoietic stem/progenitor cell quiescence [28]. This data suggests that modulating cyclin C levels may be useful for hematopoietic stem/progenitor cells expansion and more efficient engraftment. Moreover, it was shown that cell cycle regulatory effects of retinoic acid and forskolin are mediated by the cyclin C gene [29].
Cyclin G1 and cyclin G2 comprise a new family of cyclins with contrasting tissue-specific and cell cycle-regulated expression. Transcriptional activation of the cyclin G1 gene can be induced by tumor protein p53. It was shown that phosphatase 2A, which, can binds to cyclin G1and stabilize it under unstressed conditions and upon DNA damage, as well as inhibits the ability of cyclin G1 to be ubiquitinated [30]. Cyclin G2 appears to be a negative cell-cycle regulator in gastric cancer, and its expression seems to be inversely related to gastric cancer progression [31]. Its inhibitory effect on tumor growth was shown in experiments with cotylenin A, a new differentiation inducer, and rapamycin which cooperatively inhibit growth of cancer cells through induction of cyclin G2 [32].
There is data that cyclin H, which is associated with gastrointestinal stromal tumors, forms a complex with cyclin-dependent kinase-7 and ring finger protein MAT1 [33]. This kinase complex is able to phosphorylates cyclin-dependent kinase-2 and cell division cycle-2 kinase, thus functions as a cyclin-dependent kinase-activating kinase (CAK). Moreover, the cyclin H and its kinase partner are components of transcription factor II H (TFIIH) which is one of several general transcription factors that make up the RNA polymerase II preinitiation complex, as well as RNA polymerase II protein complexes and participate in two different transcriptional regulation processes, suggesting an important link between basal transcription control and the cell cycle machinery [33].
The cyclin I show the highest similarity with cyclin G. The transcript of this gene was found to be expressed constantly during cell cycle progression. The function of this cyclin has not yet been determined but the increased
level of cyclin I and GDP dissociation inhibitor GDI2 found to be associated with pancreatic carcinoma [34].
The cyclin T2 and its kinase partner cyclin-dependent kinase-9 were found to be subunits of the transcription elongation factor b (p-TEFb) and is involved in regulating P-TEFb transcriptional elongation function [35]. The p-TEFb complex containing cyclin T2 was reported to interact with, and act as a negative regulator of human immunodeficiency virus type 1 Tat protein. Moreover, the transcription initiation factor TFIID component TAF7 functionally interacts with both transcription factors TFIIH and P-TEFb [36].
There is data that calcyclin-binding protein inhibits proliferation, tumorigenicity and invasion of gastric cancer and its down-regulation is associated with poor prognosis of breast cancer [25, 37]. It may be involved in calcium-dependent ubiquitination and subsequent proteosomal degradation of target proteins. The DMTF1 gene encodes a transcription factor that contains a cyclin D-binding domain, three central Myb-like repeats, and two flanking acidic transactivation domains at the N- and C-termini. The encoded protein is induced by the oncogenic Ras signaling pathway and functions as a tumor suppressor by activating the transcription of ADP-ribosylation factor (ARF) and thus the ARF-p53 pathway to arrest cell growth or induce apoptosis. The transcriptional activity of DMTF1 protein is regulated by deleted in approximately 40% of human non-small-cell lung cancer [38, 39].
The cyclin-dependent kinase inhibitors 1A (CDKN1A, p21, Cip1) and 1B (CDKN1A, p27, Kip1) bind to and inhibit the activity of cyclin/cyclin-dependent kinases complexes, and thus function as regulators of cell cycle progression [40 - 43]. The expression of CDKN1A gene is tightly controlled by the tumor suppressor protein p53, through which this protein mediates the p53-dependent cell cycle G1 phase arrest in response to a variety of stress stimuli [41]. CDKN1A can interact with proliferating cell nuclear antigen (PCNA), a DNA polymerase accessory factor, and plays a regulatory role in S phase DNA replication and DNA damage repair. This protein was reported to be specifically cleaved by CASP3-like caspases, which thus leads to a dramatic activation of cyclin-dependent kinase-2. It was shown that expression of CDKN1B removes cyclin A but not cyclin E from centrosomes. Moreover, ectopic expression of PFKFB3 increased the expression of several key cell cycle proteins and decreased the expression of the cell cycle inhibitor p27 [44].
In this work we have studied effect of hypoxia, glucose and glutamine deprivation on the expression of different cyclin (B1, B2, C, G1, H, I and T2) and cyclin-dependent genes (calcyclin binding protein, cell division cycle-2, transcription factor DMTF, cyclin-dependent kinase inhibitors 1A and 1B) in glioma cell line U87 and modified glioma cells without endoplasmic reticulum -nuclei signaling enzyme-1 kinase and endoribonuclease activities for evaluation of cyclin and cyclin-dependent
kinase genes responsibility from this signaling enzyme-1 function.
MATERISALS AND METHODS
Cell Lines and Culture Conditions. The glioma cell line U87 was obtained from ATCC (U.S.A.) and grown in high glucose Dulbecco’s modified Eagle’s minimum essential medium supplemented with glutamine, 10% fetal bovine serum, penicillin and streptomycin at 37oC in a 5% CO2 incubator. In this work we used two sublines of this glioma cell line. One subline has suppressed both protein kinase and endoribonuclease activities of sensor endoplasmic reticulum - nuclei signaling enzyme-1 which was obtained by selection of stable transfected clones with overexpression of endoplasmic reticulum - nuclei-1 dominant/negative constructs (dnERN1). Second subline was obtained by selection of stable transfected clones with overexpression of vector, which was used for creation of dnERN1, and was used as control.
For glucose or glutamine deprivation the growing medium in culture plates were replaced on the medium without glucose or glutamine and exposed for 16 hours. Hypoxic conditions were created in special incubator with 3 % oxygen and 5 % carbon dioxide levels and culture plates were exposed for 16 hours.
RNA isolation. Total RNA was extracted from different tumor tissues and normal tissue counterparts using Trizol reagent according to manufacturer protocol (Invitrogen, U.S.A.) [45]. RNA pellets was washed with 75 % ethanol and dissolved in nuclease-free water.
Reverse transcription and quantitative PCR analysis. The expression of cyclin B1, B2, C, G1, H, I, T2 and calcyclin binding protein, as well as cell division cycle-2, transcription factor, containing cyclin D binding domain (DMTF), cyclin-dependent kinase inhibitor-1A (CDKN1A, Cip) and cyclin-dependent kinase inhibitor-1B (CDKN1B, Kip) mRNA was measured in glioma cell line U87 and its subline with endoplasmic reticulum -nuclei-1-deficiency by quantitative polymerase chain reaction of complementary DNA (cDNA) using „Stratagene Mx 3000P cycler” (U.S.A.) and SYBRGreen Mix (AB gene, Great Britain). QuaniTect Reverse Transcription Kit (QIAGEN, Germany) was used for cDNA synthesis as described previously [40]. Polymerase chain reaction was performed in triplicate.
For amplification of cyclin B1 (CCNB1) cDNA we used forward (5’- CGGGAAGTCACT GGAAACAT -3’ and reverse (5’- AAACATGGCAGT GACACCAA -3’) primers. The nucleotide sequences of these primers correspond to sequences 760 - 779 and 936 - 917 of human CCNB1 cDNA (GenBank accession number NM_031966).
The amplification of cyclin B2 (CCNB2) cDNA was performed using forward primer (5’-TTGCAGTCCATAAACCCACA -3’) and reverse primer (5’- GAAGCCAAGAGCAGAGCAGT -3’). These oligonucleotides correspond to sequences 590 - 609 and 807 - 788 of human CCNB2 cDNA (GenBank accession number NM_004701).
The amplification of cyclin C (CCNC) cDNA for real time RCR analysis was performed using two oligonucleotides primers: forward - 5’-
CATGTGTGTTTTTGGCATCC -3’ and reverse -5’-CCCATGTCCTGCACATACTG -3’. The nucleotide sequences of these primers correspond to sequences 553 -572 and 787 - 768 of human CCNC cDNA (GenBank accession number NM_005190).
Two other primers were used for real time RCR analysis of cyclin G1 (CCNG1) cDNA expression: forward - 5’- GTCCCATTGGCAACTGACTT -3’ and reverse - 5’- TGACATGCCTTCAGTTGAGC -3’. The nucleotide sequences of these primers correspond to sequences 577 - 596 and 803 - 784 of human CCNG1 cDNA (GenBank accession number NM_004060).
For amplification of cyclin H (CCNH) cDNA we used forward (5’- GCATTGACGGATGCTTACCT -3’ and reverse (5’- TGACATCGCTCCAACTTCTG -3’) primers. The nucleotide sequences of these primers correspond to sequences 834 - 853 and 1081 - 1062 of human CCNH cDNA (GenBank accession number NM_001239).
For amplification of cyclin I (CCNI) cDNA we used forward (5’- CCGTAAAGGCTCATCCAAAA -3’ and reverse (5’- GGCT GT GT GAAGAT CCC AAT -3’) primers. The nucleotide sequences of these primers correspond to sequences 780 - 799 and 979 - 960 of human CCNI cDNA (GenBank accession number NM_006835).
The amplification of cyclin T2 (CCNT2) cDNA was performed using forward primer (5’-AGT GGAAGAACAGGCT CGAA -3’) and reverse primer (5’- GGATGTCTGTGCCAAATCCT -3’). These oligonucleotides correspond to sequences 309 - 328 and 552 - 533 of human CCNT2 cDNA (GenBank accession number NM_001241).
The amplification of calcyclin BP (CALCYBP) cDNA for real time RCR analysis was performed using two oligonucleotides primers: forward - 5’-
GCAGGTGCATTTCACAGAGA -3’ and reverse - 5’-GGGTCAGGTAATCCCACCTT -3’. The nucleotide sequences of these primers correspond to sequences 552 -571 and 742 - 723 of human CALCYBP cDNA (GenBank accession number NM_001007214).
For real time RCR analysis of cell division cycle-2 (cyclin dependent kinase-1) cDNA expression we used next primers: forward - 5’-
TAGCGCGGATCTACCATACC -3’ and reverse - 5’-CCTGCATAAGCACATCCTGA -3’. The nucleotide sequences of these primers correspond to sequences 123 -142 and 371 - 352 of human CDK2 cDNA (GenBank accession number NM_001170406).
The amplification of transcription factor, containing cyclin D binding domain (DMTF) cDNA for real time RCR analysis was performed using two oligonucleotides primers: forward - 5’- GT GACCATGACTGCAACCAC -3’ and reverse - 5’- TTCTTCCTTGGACCACATCC -3’. The nucleotide sequences of these primers correspond
to sequences 822 - 841 and 1043 - 1024 of human DMTF cDNA (GenBank accession number NM_021145).
Two other primers were used for real time RCR analysis of cyclin-dependent kinase inhibitor-1A (CDKN1A, Cip) cDNA expression: forward - 5’-TTAGCAGCGGAACAAGGAGT -3’ and reverse - 5’-GCCGAGAGAAAACAGTCCAG -3’. The nucleotide sequences of these primers correspond to sequences 1777
- 1796 and 2001 - 1982 of human CDKN1A cDNA (GenBank accession number NM_000389).
For real time RCR analysis of cyclin-dependent kinase inhibitor-1B (CDKN1B, Kip1, p27) cDNA expression were used next primers: forward - 5’-AGATGTCAAACGTGCGAGTG -3’ and reverse - 5’-T CT CT GC AGT GCTT CT CCAA -3’. The nucleotide sequences of these primers correspond to sequences 471 -490 and 624 - 605 of human CDKN1B cDNA (GenBank accession number NM_004064).
The amplification of beta-actin cDNA was performed using primers: forward - 5’-
CGT ACCACT GGC AT CGT GAT -3’ and reverse - 5’-GTGTTGGCGTACAGGTCTTT -3’. The expression of beta-actin mRNA was used as control of analyzed RNA quantity. The primers were received from “Sigma” (USA).
Quantitative PCR was performed on “Stratagene Mx 3000P cycler”, using SYBR Green Mix. Analysis of quantitative PCR was performed using special computer program “Differential expression calculator” and statistic analysis - in Excel program. The amplified DNA fragments were separated on a 2 % agarose gel and that visualized by 5x Sight DNA Stain (EUROMEDEA).
RESULTS AND DISCUSSION
In this investigation, we used human glioma cell line U87 and its genetically modified variant (deficient in signaling enzyme endoplasmic reticulum - nuclei-1) to study the involvement of endoplasmic reticulum stress system in the effect of hypoxia, glutamine and glucose deprivation on the expression of different genes of cyclins and cyclin dependent kinases. For this aim, the cells were incubated at 37 oC before harvesting in regular DMEM medium (control) and in the medium without glucose or glutamine for 16 hours or in hypoxic chamber. Total RNA was extracted from cells, converted into complementary DNA and readily quantified by real time polymerase chain reaction.
We have found that cyclin B1, B2, C, G1, H, I and T2 mRNA are expressed in the human glioma cell line U87 and the level of its expression is depended from endoplasmic reticulum - nuclei signaling enzyme-1 function as well as from hypoxia, glutamine or glucose deprivation. As shown in fig. 1, the level of cyclin B1 mRNA expression is decreased on 58 % in glioma cells, deficient in signaling enzyme endoplasmic reticulum -nuclei-1, as compared to control cells. Exposure cells during 16 hours in glutamine or glucose deprivation conditions leads to decrease of cyclin B1 mRNA expression level both in control cells (-33 and -24 %,
correspondingly) and genetically modified cells with suppressed function of signaling enzyme endoplasmic reticulum - nuclei-1 (-45 and -19 %, correspondingly). Hypoxia also decreased the expression of this mRNA (37 %) but in control cells only.____________________________
Fig. 1. Expression of cyclin B1 mRNA in glioma cell line U87 and its subline with signaling enzyme endoplasmic reticulum -nuclei-1 (ERN1)-deficiency measured by quantitative polymerase chain reaction. Values of cyclin B1 mRNA expressions were normalized to beta-actin mRNA expression and represent as percent for control (100 %); n = 3; * - P < 0.05 as compared to control 1; **- P < 0.05 as compared to control 2.
Investigation the expression level of cyclin B2 mRNA is shown much less decrease (-21 %) in glioma cells with suppressed activity of signaling enzyme endoplasmic reticulum - nuclei-1 as compared to control glioma cells (fig. 2). At the same time, the effect of glutamine deprivation on the expression of this mRNA level was observed in endoplasmic reticulum - nuclei-1 signaling enzyme-deficient glioma cells only, but effect of hypoxia - only in control cells. Significant decrease of the level of cyclin B2 mRNA expression was shown under glucose deprivation condition in both types of tested cells.
120
100
80
60
40
20
0
rh
r+1
*
I
0) .ES CM Q .
E •= *5 > O Z U CL x O O E £ O z U CL
if 0» > X c o o If 3 o
o CD
Vector dnERNI
0
Fig. 2. Expression of cyclin B2 mRNA in glioma cell line U87 and its subline with signaling enzyme endoplasmic reticulum -nuclei-1 (ERN1)-deficiency measured by quantitative polymerase chain reaction. Values of cyclin B2 mRNA expressions were normalized to beta-actin mRNA expression and represent as percent for control (100 %); n = 3; * - P < 0.05 as compared to control 1; **- P < 0.05 as compared to control 2.
As shown in fig. 3 and 4, the levels of cyclin C and G1 mRNA expression are also decreased (-13 and -45 %) in glioma cells with suppressed activity of signaling enzyme endoplasmic reticulum - nuclei-1 as compared to control glioma cells. No significant changes were found in
the level of cyclin C mRNA expression in both types of tested cells under glutamine deprivation conditions but hypoxia and glucose deprivation significantly decreased cyclin C mRNA expression level (fig. 3). However, investigation the effect of glutamine or glucose deprivation conditions on glioma cells is shown the significant increase in the expression of cyclin G1 mRNA level both in control and endoplasmic reticulum - nuclei-1 signaling enzyme-deficient glioma cells: +33 % and +26 % - in control cells and +21 % and +41 % - in
genetically modified cells, correspondingly (fig. 4).______
z 120
2
c 100
i+i
rh
rh
rh
rh
I •=
ro a.
* *
n
Fig. 3. Expression of cyclin C mRNA in glioma cell line U87 and its subline with signaling enzyme endoplasmic reticulum -nuclei-1 (ERN1)-deficiency measured by quantitative polymerase chain reaction. Values of cyclin C mRNA expressions were normalized to beta-actin mRNA expression and represent as percent for control (100 %); n = 3; * - P < 0.05 as compared to control 1; **- P < 0.05 as compared to control 2.
160
140
120
100
so
60
40
20
0
r+i
rh
| ■= If
o z
« O. = 0) O ■o
Vector
£ •= If
u
dnERNI
Fig. 4. Expression of cyclin G1 mRNA in glioma cell line U87 and its subline with signaling enzyme endoplasmic reticulum -nuclei-1 (ERN1)-deficiency measured by quantitative polymerase chain reaction. Values of cyclin G1 mRNA expressions were normalized to beta-actin mRNA expression and represent as percent for control (100 %); n = 3; * - P < 0.05 as compared to control 1; **- P < 0.05 as compared to control 2.
At the same time no significant changes were found in the expression level of cyclin H mRNA in genetically modified cells (fig. 5). Moreover, hypoxia and glutamine deprivation conditions in glioma cells with suppressed activity of signaling enzyme endoplasmic reticulum - nuclei-1 significantly changed the expression level of cyclin H mRNA in control glioma cells, but glucose deprivation conditions leads to significant increase in the expression level of cyclin H mRNA in endoplasmic reticulum - nuclei-1 signaling enzyme-deficient cells (+61 %).
Fig. 5. Expression of cyclin H mRNA in glioma cell line U87 and its subline with signaling enzyme endoplasmic reticulum -nuclei-1 (ERN1)-deficiency measured by quantitative polymerase chain reaction. Values of cyclin H mRNA expressions were normalized to beta-actin mRNA expression and represent as percent for control (100 %); n = 3; * - P < 0.05 as compared to control 1; **- P < 0.05 as compared to control 2.
_ 250
150
50
rh
= -a
o
Vector
r+1
dnERNI
Fig. 8. Expression of calcyclin binding protein (CALCYBP) mRNA in glioma cell line U87 and its subline with signaling enzyme endoplasmic reticulum - nuclei-1 (ERN1)-deficiency measured by quantitative polymerase chain reaction. Values of cyclin CALCYBP mRNA expressions were normalized to beta-actin mRNA expression and represent as percent for control (100 %); n = 3; * - P < 0.05 as compared to control 1; ** - P < 0.05 as compared to control 2._____________________________
Fig. 6. Expression of cyclin I mRNA in glioma cell line U87 and its subline with signaling enzyme endoplasmic reticulum -nuclei-1 (ERN1)-deficiency measured by quantitative polymerase chain reaction. Values of cyclin I mRNA expressions were normalized to beta-actin mRNA expression and represent as percent for control (100 %); n = 3; * - P < 0.05 as compared to control 1; **- P < 0.05 as compared to control 2.
Fig. 9. Expression of transcription factor DMTF mRNA in glioma cell line U87 and its subline with signaling enzyme endoplasmic reticulum - nuclei-1 (ERN1)-deficiency measured by quantitative polymerase chain reaction. Values of DMTF mRNA expressions were normalized to beta-actin mRNA expression and represent as percent for control (100 %); n = 3; * - P < 0.05 as compared to control 1; ** - P < 0.05 as compared to control 2.
z 140
O
£ 120 " 100 £ 80
GO
40
20
0
[
rh
E = 3 g-
= T3
O
A
r+l
Vector
ri
E •= 2 g-2. -o O
A
dnERNI
Fig. 7. Expression of cyclin T2 mRNA in glioma cell line U87 and its subline with signaling enzyme endoplasmic reticulum -nuclei-1 (ERN1)-deficiency measured by quantitative polymerase chain reaction. Values of cyclin T2 mRNA expressions were normalized to beta-actin mRNA expression and represent as percent for control (100 %); n = 3; * - P < 0.05 as compared to control 1; **- P < 0.05 as compared to control 2.
180 i 160 140 120 100 80 60 40 20 0
rh
nh
Vector
E
(D
dnERNI
Fig. 10. Expression of cell division cycle-2 (CDC2) mRNA in glioma cell line U87 and its subline with signaling enzyme endoplasmic reticulum - nuclei-1 (ERN1)-deficiency measured by quantitative polymerase chain reaction. Values of cyclin CDC2 mRNA expressions were normalized to beta-actin mRNA expression and represent as percent for control (100 %); n = 3; * - P < 0.05 as compared to control 1; ** - P < 0.05 as compared to control 2.
200
180
160
140
120
100
'55 60
2 40
I 20 « 0 z 0£
E
<
rh
Hn
E |
fO Q.
5 ■c
<D
o -z
s <u
O "o
—E—i
a
x
Vector
o
o
l+l
11
o 'Z O CL
0 -O
dnERNI
Fig. 11. Expression of cyclin-dependent kinase inhibitor 1A (CDKN1A) mRNA in glioma cell line U87 and its subline with signaling enzyme endoplasmic reticulum - nuclei-1 (ERN1)-deficiency measured by quantitative polymerase chain reaction. Values of CDKN1A mRNA expressions were normalized to beta-actin mRNA expression and represent as percent for control (100 %); n = 3; * - P < 0.05 as compared to control 1; ** - P < 0.05 as compared to control 2._________________________
= 200 £ 180
0 160
E 140 2 120 5 100 c 80 "35 60
g 40
1 20
rb
n
Vector
dnERNI
Fig. 12. Expression of cyclin-dependent kinase inhibitor 1B (CDKN1B) mRNA in glioma cell line U87 and its subline with signaling enzyme endoplasmic reticulum - nuclei-1 (ERN1)-deficiency measured by quantitative polymerase chain reaction. Values of CDKN1B mRNA expressions were normalized to beta-actin mRNA expression and represent as percent for control (100 %); n = 3; * - P < 0.05 as compared to control 1; ** - P < 0.05 as compared to control 2.
Results of investigation of cyclin I mRNA expression level are shown in fig. 6. Thus, the blockade of the activity of endoplasmic reticulum - nuclei-1 signaling enzyme leads to induction of this mRNA expression level (+31 %) as compared to control cells. Moreover, hypoxia and glutamine or glucose deprivation conditions significantly induce the expression level of cyclin I mRNA in both types of tested cells.
The level of cyclin T2 mRNA expression is decreased under glucose deprivation conditions and increased under glutamine deprivation conditions in control glioma cells only (fig. 7). No significant changes were found in the level of cyclin T2 mRNA expression in both types of tested cells under hypoxic conditions. However, in genetically modified cells we observed the decrease of cyclin G2 mRNA expression level in glucose deprivation conditions (-44 %). both investigated cell types: -61 % and -55 % - in control cells and -75 % and -73 % - in genetically modified cells, correspondingly.
It was also shown that expression levels of cyclin-dependent genes (calcyclin binding protein, cell division cycle-2 and transcription factor DMTF) are increased in glioma cells without activity of endoplasmic reticulum -nuclei-1 signaling enzyme: + 20, + 20 and + 51 %, correspondingly (fig. 8 - 10). The expression levels of calcyclin binding protein and cell division cycle-2 are decreased in both types of tested cells. However, effect of hypoxia and glucose deprivation conditions was different for these genes and depends from activity of endoplasmic reticulum - nuclei-1 signaling enzyme. Thus, hypoxia is decreased the expression level of cell division cycle-2 mRNA in both types of tested cells and calcyclin binding protein mRNA - in control cells only (fig. 8 and 10). At the same time, the expression level of transcription factor DMTF mRNA is increased in control cells and is decreased in glioma cells without activity of endoplasmic reticulum - nuclei-1 signaling enzyme (fig. 9).
As shown in fig. 11 and 12, the expression level of cyclin-dependent kinase inhibitor 1B mRNA is decreased (-20 %) is decreased in glioma cells without activity of endoplasmic reticulum - nuclei-1 signaling enzyme but no significant changes was observed in the expression level of cyclin-dependent kinase inhibitor 1A mRNA. Exposure cells under hypoxia as well as in the medium without glutamine or glucose leads to significant increase in cyclin-dependent kinase inhibitor 1A mRNA expression level in both investigated cell types, except genetically modified cells exposure under glucose deprivation condition (fig. 11). However, more significant of hypoxia was observed in both types of tested glioma cells on the expression levels of cyclin-dependent kinase inhibitor 1B (fig. 12). At the same time, expression level of cyclin-dependent kinase inhibitor 1B is increased in control cells under glutamine deprivation conditions and decreased in glioma cells without activity of endoplasmic reticulum - nuclei-1 signaling enzyme both under glutamine and glucose deprivation conditions (fig. 12).
It has been known that the neovascularization process, tumor growth and cellular death processes are linked to the stress and its sensing and signal transduction pathways, endoplasmic reticulum - nuclei-1 signaling pathways in particular, because the complete blockade of this signaling enzyme activity had anti-tumor effects, especially in glioblastoma, the most frequent primary brain neoplasms [15-17]. Malignant gliomas represent the transformed astrocytes, the most abundant cell type in mammalian brain, which play an important role in the maintenance and regeneration of neuronal functions. Moreover, the growing tumor requires ischemia and hypoxia which initiate the endoplasmic reticulum stress for own neovascularization and growth, for apoptosis inhibition [15]. It is known that many cyclins, cyclin-dependent kinases and its inhibitors, retinoblastoma proteins and E2F transcription factors are the components of endoplasmic reticulum stress system as well as participate in the control of cell cycle and proliferation processes [20, 21].
For this study we select several cyclins such as cyclin B1, B2, C, H, I, T2 and G1 as well as several cyclin-dependent genes, calcyclin binding protein, cell division cycle-2, transcription factor DMTF and cyclin-dependent kinase inhibitor 1A and 1B, which play an important role in the control of malignant tumor growth, including glioblastoma [20, 22, 23, 25, 36, 37]. Malignant glioma are the most frequent primary brain tumors and represent a major challenge in cancer therapy, but glioma are not easily accessible to current therapies. However, the molecular mechanisms underlying these seemingly mutually exclusive behaviors have not been elucidated. This provides a rationale for the molecular analysis of expression signatures of invasive and growth patterns in glioma cells for a comprehensive approach of these complex mechanisms. Because bifunctional transmembrane signaling enzyme endoplasmic reticulum
- nuclei-1 is a major proximal sensor of the unfolded protein response, it participates in the early cellular response to the accumulation of misfolded proteins in the endoplasmic reticulum under both physiological and pathological situations and in malignant tumors, in particular [15, 17]. Therefore, in this work we studied the expression of several key cyclin and cyclin-dependent kinase genes in glioma cells without activity of endoplasmic reticulum - nuclei-1 signaling enzyme for the evaluation of cyclin and cyclin-dependent kinase genes responsibility from this signaling enzyme-1 function because as known the complete blockade of this signaling enzyme activity had anti-tumor effects [15, 16].
Results of this investigation clearly demonstrated that the expression levels of cyclins G1, B1, B2, C and T2 which form a complex with cyclin-dependent kinases and responsible for tumor growth are decreased in glioma cells without endoplasmic reticulum - nuclei-1 signaling enzyme function. This data correlates with lower proliferation rate of these genetically modified cells [15, 17] as well as with biological significance of cyclins studied [23, 24, 33, 36]. Thus, the lover level of cyclin B1 in glioma cells without endoplasmic reticulum - nuclei-1 signaling enzyme function could activate apoptosis via decreasing of cyclin B1/cyclin-dependent kinase-1 phosphorylation of mitochondrial p53 [23]. Decreased level of cyclin B2 expression and lower proliferation rate of these genetically modified cells are correlated with a key role of cyclin B2/cell division cycle-2 complex in transforming growth factor beta-mediated cell cycle control. We have shown significant reduction of cyclin G1 level in glioma cells without endoplasmic reticulum -nuclei-1 enzyme function which can be responsive for decreased expression of cyclin B1 because cyclin G1 mediates the transcriptional activation of cyclin B1 [27]. Moreover, the cyclin T2 and its kinase partner cyclin-dependent kinase-9 were found to be subunits of the transcription elongation factor b (p-TEFb) and is involved in regulating P-TEFb transcriptional elongation function as well as transcription initiation because P-TEFb together with transcription factors TFIIH functionally interacts with TAF7 component of the transcription initiation factor TFIID [35, 36].
At the same time, we have shown that the blockade of endoplasmic reticulum - nuclei-1 signaling enzyme function did not change significantly the expression level of cyclin H and increased the expression level of cyclin I. It is possible that cyclin H does not participate in endoplasmic reticulum - nuclei-1 signaling because it plays more general function. Thus, there is data that cyclin H and cyclin-dependent kinase-7 are components of transcription factor II H which is one of several general transcription factors that make up the RNA polymerase II preinitiation complex and participate in two different transcriptional regulation processes, suggesting an important link between basal transcription control and the cell cycle machinery [33]. Moreover, the complex of cyclin H with cyclin-dependent kinase-7 and ring finger protein MAT1 is able to phosphorylates cell division cycle-2 kinase and cyclin-dependent kinase-2, thus functions as a cyclin-dependent kinase-activating kinase [33]. The function of cyclin I have not yet been determined and its increased level possible connected with specific role of cyclin I in cell cycle regulation. There is data that cyclin I transcript is expressed constantly during cell cycle progression [34].
Moreover, we have shown that the expression levels of calcyclin binding protein, which appears to be a negative cell-cycle regulator in cancer, as well as DMTF1, transcription factor that contains a cyclin D-binding domain and functions as a tumor suppressor, are increased in glioma cells with suppressed activity of endoplasmic reticulum - nuclei-1 signaling enzyme. These our results are also correlated with decreased proliferative rate of genetically modified glioma cells [15, 17] and data Nie et al. and Tschan et al. [25, 39]. Thus, calcyclin-binding protein inhibits proliferation of cancer cells [37]. The DMTF1 can arrest cell growth and induce apoptosis by activating the transcription of ADP-ribosylation factor and thus the p53 pathway [38].
We have also shown that mRNA expression levels of most studied genes are also decreased under hypoxic and glucose or glutamine deprivation conditions both in control and endoplasmic reticulum - nuclei-1-deficient glioma cells, but expression levels of cyclin G1 and I as well as cyclin-dependent kinase inhibitor-1A are increased at these conditions. However, the expression level of cyclin B1, H, T2 and calcyclin binding protein is decreased in hypoxic conditions in control cells only. Thus, the effect of hypoxia on the expression of these genes depends from endoplasmic reticulum - nuclei-1 signaling enzyme. Moreover, effect of hypoxia and glutamine or glucose deprivation conditions on the expression of transcription factor DMTF1 strongly depends from endoplasmic reticulum - nuclei-1 signaling because we observed induction of the expression of DMTF1 in control cells and suppression in genetically modified glioma cells in all experimental conditions. Similar results we received with cyclin-dependent kinase inhibitors 1B: its expression level in glutamine
deprivation conditions is increased in control glioma cells and decreased in genetically modified cells but in glucose
deprivation conditions did not change significantly in control cells and decreased in genetically modified glioma cells. At the same time, hypoxia is increased the expression level of cyclin-dependent kinase inhibitors 1B in both cell types.
The major finding reported here is that the expression of most tested genes encoded cyclins and cyclin-dependent kinases is dependent from endoplasmic reticulum - nuclei-1 signaling enzyme function both in normal, hypoxic and glutamine or glucose deprivation conditions and possibly participate in cell adaptive response to endoplasmic reticulum stress associated with these factors. However, the detailed molecular mechanisms of the regulation of genes encoded cyclins and cyclin-dependent kinases by endoplasmic reticulum -nuclei-1 signaling system under hypoxia and ischemic stress conditions is complex and warrants further study.
CONCLUSIONS
Results of these investigations clearly demonstrated that the expression of different cyclin as well as cyclin-dependent genes in glioma cells is regulated by hypoxia, glutamine and glucose deprivation and significantly depends from protein kinase and endoribonuclease activities of signaling enzyme endoplasmic reticulum - nuclei-1 and possibly participate in cell adaptive response to endoplasmic reticulum stress associated with glutamine and glucose deprivation.
References
1. Luo D., He Y., Zhang H., Yu L. et al. AIP1 is critical in transducing IRE 1-mediated endoplasmic reticulum stress response // J. Biol. Chem. - 2010. - Vol. 283, N 18. - P. 11905 -11912.
2. Bi M., Naczki C., Koritzinsky M., Fels D., Blais J., Hu N.,
Harding H., Novoa I., Varia M., Raleigh J., Scheuner D.,
Kaufman R.J., Bell J., Ron D., Wouters B.G., Koumenis C. ER stress-regulated translation increases tolerance to extreme hypoxia and promotes tumor growth // EMBO J. - 2005. -Vol. 24, N 19. - P. 3470 - 3481.
3. Blais J.D., Filipenko V., Bi M., Ron D., Koumenis C.,
Wouters B.G., Bell J.C. Transcription factor 4 is
translationally regulated by hypoxic stress // Mol. Cell. Biol.
- 2004. - Vol. 24. - P. 7469 - 7482.
4. Denko N.C. Hypoxia, HIF1 and glucose metabolism in the solid tumour // Nature Reviews Cancer. - 2008. - Vol. 8. -P. 705 - 713.
5. Fels D.R., Koumenis C. The PERK/eIF2a/ATF4 module of the UPR in hypoxia resistance and tumor growth // Cancer Biol. Therap. - 2006. - Vol. 5, N 7. - P. 723 - 728.
6. Korennykh A.V., EgeaP.F., KorostelevA.A., Finer-Moore J., Zhang C., Shokat K.M., Stroud R.M., Walter P. The unfolded protein response signals through high-order assembly of Ire1// Nature. - 2009. - Vol. 457, N 7230. - P. 687 - 693.
7. Romero-Ramirez L., Cao H., Nelson D., Hammond E., Lee A.H., Yoshida H., Mori K., Glimcher L.H., Denko N.C., Giaccia A.J., Le Q.-T., Koong A.C. XBP1 is essential for survival under hypoxic conditions and is required for tumor growth // Cancer Research. - 2004. - Vol. 64. - P. 5943 -5947.
8. Lin J.H., Li H., Yasumura D., Cohen H.R., Zhang C., Panning B., Shokat K.M., Lavail M.M., Walter P. IRE1 signaling affects cell fate during the unfolded protein response // Science. - 2007. - Vol. 318. - P. 944 - 949.
9. Hetz C., Glimcher L.H. Fine-tuning of the unfolded protein response: assembling the IRE1alpha interactome // Mol. Cell.
- 2009. - Vol. 35, N 9. - P. 551 - 561.
10. Aragon T., van Anken E., Pincus D., Serafmova I.M., Korennykh A.V., Rubio C.A., Walter P. Messenger RNA targeting to endoplasmic reticulum stress signalling sites // Nature. - 2009. - Vol. 457, N 7230. - P. 736 - 740.
11. Hollien J, Lin J.H., Li H., Stevens N., Walter P., Weissman J.S. Regulated Ire 1-dependent decay of messenger RNAs in mammalian cells // J. Cell Biol. - 2009. - Vol. 186, N 3. - P. 323 - 331.
12. Acosta-Alvear D., Zhou Y., Blais A., Tsikitis M., Lents N.H., Arias C., Lennon C.J., Kluger Y., Dynlacht D.D. XBP1 controls diverse cell type- and condition-specific transcriptional regulatory networks // Mol. Cell. - 2007. -Vol. 27. - P. 53 - 66.
13. Han D., Upton J.-P., Hagen A., Callahan J., Oakes S.A., Papa F.R. A kinase inhibitor activates the IRE1alpha RNase to confer cytoprotection against ER stress // Biochem. Biophys. Res. Commun. - 2008. - Vol. 365. - P. 777 - 783.
14. Greenman C., Stephans P., Smith R., Dalgliesh G.L., Hunter C., Bignell G., Davies H. et al. Patterns of somatic mutation in human genomes // Nature. - 2007. - Vol. 446. - P. 153 -158.
15. Auf G., Jabouille A., Guerit S., Pineau R., Delugin M., Bouchecareilh M., Favereaux A., Maitre M., Gaiser T., von Deimling A., CzabankaM., Vajkoczy P., Chevet E., Bikfalvi A., Moenner M. A shift from an angiogenic to invasive phenotype induced in malignant glioma by inhibition of the unfolded protein response sensor IRE1// Proc. Natl. Acad. Sci. U.S.A. - 2010. - Vol. 107, N 35. - P. 15553 -15558.
16. Drogat B., Auguste P., Nguyen D.T., Bouchecareilh M., Pineau R., Nalbantoglu J., Kaufman R.J., Chevet E., Bikfalvi A., Moenner M. IRE1 signaling is essential for ischemia-induced vascular endothelial growth factor-A expression and contributes to angiogenesis and tumor growth in vivo // Cancer Res. - 2007. - Vol. 67. - P. 6700 -6707.
17. Moenner M., Pluquet O., Bouchecareilh M., Chevet E. Integrated endoplasmic reticulum stress responses in cancer // Cancer Res. - 2007. - Vol. 67, N 22. - P. 10631 -10634.
18. Guan D., Xu Y., Yang M., Wang H., Wang X., Shen Z. N-
acetyl cysteine and penicillamine induce apoptosis via the ER stress response-signaling pathway // Mol.
Carcinogenesis. - 2010. - Vol. 49, N 1. - P. 68 - 74.
19. Saito A., Ochiai K., Kondo S., Tsumagari K., Murakami T., Cavener D.R., Imaizumi K. Endoplasmic Reticulum Stress Response Mediated by the PERK-eIF2-ATF4 Pathway Is Involved in Osteoblast Differentiation Induced by BMP2// J. Biol. Chem. - 2011. - Vol. 286, N 6. - P. 4809 - 4818.
20. Maddika S., Ande S.R., Panigrahi S., Paranjothy T., Weglarczyk K., Zuse A., Eshraghi M., Manda K.D., Wiechec E., Los M. Cell survival, cell death and cell cycle pathways are interconnected: implications for cancer therapy // Drug Resistance Updat. - 2007. - Vol. 10, N 1-2. - P. 13 - 29.
21. Polager S., Ginsberg D. p53 and E2f: partners in life and death // Nature Reviews Cancer. - 2009. - Vol. 9, N 10. - P. 738 - 748.
22. Malumbres M., Harlow E., Hunt T., Hunter T., Lahti J.M., Manning G., Morgan D.O., Tsai L.H., Wolgemuth D.J. Cyclin-dependent kinases: a family portrait // Nat. Cell Biol.
- 2009. - Vol. 11, N 11. - P. 1275 - 1276.
23. Nantajit D., Fan M., Duru N., Wen Y., Reed J.C., Li J.J. Cyclin B1/Cdk1 phosphorylation of mitochondrial p53 induces anti-apoptotic response // PLoS ONE. - 2010. - Vol.
5, N 8. - P. E12341.
24. Linares J.F., Amanchy R., Diaz-Meco M.T., Moscat J. Phosphorylation of p62 by cdk1 controls the timely transit of cells through mitosis and tumor cell proliferation // Mol. Cell. Biol. - 2011. - Vol. 31, N 1. P. 105 - 117.
25. Nie F., Yu X.L., Wang X.G, Tang Y.F., Wang L.L., Ma L. Down-regulation of CacyBP is associated with poor prognosis and the effects on COX-2 expression in breast cancer // Int. J. Oncol. - 2010. - Vol. 37, N 5. - P. 1261 -1269.
26. Matthess Y., Raab M., Sanhaji M., LavrikI.N., Strebhardt K. Cdk1/cyclin B1 controls Fas-mediated apoptosis by regulating caspase-8 activity // Mol. Cell. Biol. - 2010. -Vol. 30, N 24. - P. 5726 - 5740.
27. Seo H.R., Kim J., Bae S., Soh J.W., Lee Y.S. Cdk5-mediated phosphorylation of c-Myc on Ser-62 is essential in transcriptional activation of cyclin B1 by cyclin G1 // J. Biol. Chem. - 2008. - Vol. 283, N 23. P. 15601 - 15610.
28. Miyata, Y., Liu Y., Jankovic V., Sashida G., Lee J.M., Shieh J.H., Naoe T., Moore M., Nimer S.D. Cyclin C regulates human hematopoietic stem/progenitor cell quiescence // Stem Cells. - 2010. - Vol. 28, N 2. - P. 308 - 317.
29. Makkonen K.M., Malinen M., Ropponen A., Vaisanen S., Carlberg C. Cell cycle regulatory effects of retinoic acid and forskolin are mediated by the cyclin C gene // J. Mol. Biol. -
2009. - Vol. 393, N 2. - P. 261 - 271.
30. Li H., Okamoto K., PeartM.J., Prives C. Lysine-independent turnover of cyclin G1 can be stabilized by B'alpha subunits of protein phosphatase 2A // Mol. Cell. Biol. - 2009. - Vol. 29, N 3. P. 919 - 928.
31. Choi M.G., Noh J.H., An J.Y., Hong S.K., Park S.B., Baik Y.H., Kim K.M., Sohn T.S., Kim S. Expression levels of cyclin G2, but not cyclin E, correlate with gastric cancer progression // J. Surg. Res. - 2009. - 157, N 2. - P. 168 -174.
32. Kasukabe T., Okabe-Kado J., Honma Y. Cotylenin A, a new differentiation inducer, and rapamycin cooperatively inhibit growth of cancer cells through induction of cyclin G2 // Cancer Sci. - 2008. - 99, N 8. - P. 1693 -1698.
33. Dorn J., Spatz H., Schmieder M., Barth T.F., Blatz A., Henne-Bruns D., Knippschild U., Kramer K. Cyclin H expression is increased in GIST with very-high risk of malignancy // BMC Cancer. - 2010. - Vol. 10. - P. 350.
34. Sun Z.L., Zhu Y., Wang F.Q., Chen R., Peng T., Fan Z.N., Xu Z.K., Miao Y. Serum proteomic-based analysis of pancreatic
carcinoma for the identification of potential cancer biomarkers // Biochim. Biophys. Acta. - 2007. - Vol. 1774, N 6. - P. 764-771.
35. Fu J., Yoon H.G., Qin J., Wong J. Regulation of P-TEFb elongation complex activity by CDK9 acetylation // Mol. Cell. Biol. - 2007. - Vol. 27, N 13. - P. 4641 - 4651.
36. Gegonne A., Weissman J.D., Lu H., Zhou M., Dasgupta A., Ribble R., Brady J.N., Singer D.S. TFIID component TAF7 functionally interacts with both TFIIH and P-TEFb // Proc. Natl. Acad. Sci. U.S.A. - 2008. - Vol. 105, N 14. -
P. 5367 - 5372.
37. NingX., Sun S., Hong L., Liang J., Liu L., Han S., Liu Z., Shi Y., Li Y., Gong W., Zhang S., Chen Y., Guo X., Cheng Y., Wu K., Fan D. Calcyclin-binding protein inhibits proliferation, tumorigenicity, and invasion of gastric cancer // Mol. Cancer Res. - 2007. - Vol. 5, N 12. - P. 1254 - 1262.
38. Inoue K., Sugiyama T., Taneja P., Morgan R.L., Frazier D.P. Emerging roles of DMP1 in lung cancer // Cancer Res. -2008. - Vol. 68, N 12. - P. 4487 - 4490.
39. Tschan M.P., Gullberg U., Shan D, Torbett B.E., Fey M.F., Tobler A. The hDMP1 tumor suppressor is a new WT1 target in myeloid leukemias // Leukemia. - 2008. - Vol. 22, N 5. -P. 1087 - 1090.
40. Lee Y.H., BedfordM.T., StallcupM.R. Regulated recruitment of tumor suppressor BRCA1 to the p21 gene by coactivator methylation // Genes Dev. - 2011. - Vol. 25, N 2. - P. 176 -188.
41. Mitselou A., Karapiperides D., Nesseris I., Vougiouklakis T., Agnantis N.J. Altered expression of cell cycle and apoptotic proteins in human liver pathologies // Anticancer Res. -
2010. - Vol. 30, N 11. - P. 4493 - 4501.
42. Molatore S., Marinoni I., Lee M., Pulz E., Ambrosio M.R., degli Uberti E.C., Zatelli M.C., Pellegata N.S. A novel germline CDKN1B mutation causing multiple endocrine tumors: clinical, genetic and functional characterization // Hum. Mutat. - 2010. - Vol. 31, N 11. - P. E1825 - E1835.
43. Buecher B., Gauthier-Villars M., Desjardins L., Lumbroso-Le Rouic L., Levy C., De Pauw A., Bombled J., Tirapo C., Houdayer C., Bressac-de Paillerets B., Stoppa-Lyonnet D. Contribution of CDKN2A/P16 (INK4A), P14 (ARF), CDK4 and BRCA1/2 germline mutations in individuals with suspected genetic predisposition to uveal melanoma // Fam. Cancer. - 2010. - 9, N 4. - P. 663 - 667.
44. Yalcin A., Clem B.F., Simmons A., Lane A., Nelson K., Clem A.L., Brock E., Siow D., Wattenberg B., Telang S., Chesney J. Nuclear targeting of 6-phosphofructo-2-kinase (PFKFB3) increases proliferation via cyclin-dependent kinase // J. Biol. Chem. - 2009. - 284, N 36. - P. 24223 - 24232.
45. Kulinich A.O., Minchenko D.O., Maslak A.S., Shevtsova А.І., Brazaluk O.Z., Minchenko O.H. Експресія фібронектину та розподіл лімфоцитів за його локалізацією у цих клітинах при еритремії //Ukr.Biokhim. Zh.-2010.-82, N 4.-P.53-59.
ВПЛИВ ГІПОКСІЇ І ВІДСУТНОСТІ ГЛЮТАМІНУ АБО ГЛЮКОЗИ У СЕРЕДОВИЩІ НА ЕКСПРЕСІЮ ЦИКЛШІВ В1, В2, С, а, Н, I, Т2 та деяких циклін-залежних генів у клітинах гліоми
Мінченко Д.О., Карбовський Л.Л., Терлецький Б.М., Губеня О.В., Моне М., Мінченко О.Г.
Гіпоксія та ішемія ініціюють комплекс складних внутрішньоклітинних сигнальних подій, відомих як реакція на неправильне згортання протеїнів, яка опосередковується сенсорним ензимом ендоплазматичний ретикулум - ядро-1 і яка необхідна для протікання процесів неоваскуляризації та проліферації. Компонентами системи стресу ендоплазматичного ретикулуму є численна родина циклінів, циклін-залежних кіназ та їх інгібіторів, а також групи протеїнів ретинобластоми та транскрипційних факторів Б2Р, які і приймають участь в контролі протікання процесів неоваскуляризації та проліферації. Ми вивчали вплив гіпоксії та умов ішемії (за відсутності у середовищі глюкози або глютаміну) на експресію генів, що приймають участь у контролі клітинного циклу та проліферації, в клітинах гліоми лінії И87 та в сублінії цих клітин, дефіцитній за сенсорним ензимом ендоплазматичний ретикулум - ядро-1. Встановлено, що блокада сигнального ензиму ендоплазматичний ретикулум - ядро-1, ключового сенсора стресу ендоплазматичного ретикулуму, приводить до зниження рівня експресії мРНК циклінів В1, В2, С, 01 та Т2. Разом з тим, рівень експресії мРНК цикліну І та протеїну, що зв’язує кальциклін, а також кінази цикл поділу клітин-2 (циклін-залежної кінази-1) та транскрипційного фактора БМТБ збільшується в клітинах гліоми, дефіцитних за сигнальним ензимом ендоплазматичний ретикулум - ядро-1. Було також показано, що рівень експресії більшості досліджених генів також знижувався за умов гіпоксії та відсутності у середовищі глюкози або глютаміну як у контрольних, так і в дефіцитних за ензимом ендоплазматичний ретикулум - ядро-1 клітинах гліоми, але рівень експресії цикліну 01 та І, а також інгібітору 1А циклін-залежних кіназ збільшувався за цих умов. Таким чином, результати цієї роботи переконливо свідчать про залежність рівня експресії більшості досліджених генів, що кодують синтез циклінів та циклін-залежних протеїнів, від функції сигнального ензиму ендоплазматичний ретикулум -ядро-1 як за нормальних умов, так і за умов гіпоксії та відсутності глютаміну і глюкози, і які можливо приймають участь у реакції адаптації клітин до стресу ендоплазматичного ретикулуму, пов’ язаного з цими факторами.
Ключові слова: експресія мРНК, цикліни В1, В2, С, 01, Н, I та Т2, цикл поділу клітини-2, клітини гліоми, ендоплазматичний ретикулум - ядро-1, гіпоксія, відсутність глюкози або глютаміну
ВЛИЯНИЕ ГИПОКСИИ И ОТСУТСТВИЯ ГЛЮТАМИНА ИЛИ ГЛЮКОЗЫ В СРЕДЕ НА ЭКСПРЕССИЮ ЦИКЛИНОВ В1, В2, С, С1, Н, I, Т2 И НЕКОТОРЫХ ЦИКЛИН-ЗАВИСИМЫХ генов в клетках глиомы
Минченко Д.А., Карбовский Л.Л., Терлецький Б.М., Губеня О.В., Моне М., Минченко А.Г.
Гипоксия и ишемия инициируют комплекс сложных внутриклеточных сигнальных событий, известных как реакция на неправильное сворачивание протеинов, которая опосредуется сенсорным энзимом эндоплазматический ретикулум - ядро-1 и которая необходима для протекания процессов неоваскуляризации и пролиферации. Компонентами системы стресса эндоплазматического ретикулума есть многочисленное семейство циклинов, циклин-зависимых киназ и их ингибиторов, а также группы протеинов ретинобластомы и транскрипционных факторов Б2Р, которые и принимают участие в контроле протекания процессов неоваскуляризации и пролиферации. Мы исследовали влияние гипоксии и условий ишемии (отсутствия в среде глюкозы или глютамина) на экспрессию генов, которые принимают участие в контроле клеточного цикла и пролиферации, в клетках глиомы линии И87 и дефицитной за сенсорным энзимом эндоплазматический ретикулум
- ядро-1 сублинии этих клеток. Установлено, что блокада сигнального энзима эндоплазматический ретикулум - ядро-1, ключевого стресс сенсора эндоплазматического ретикулума, приводит к снижению уровня экспрессии мРНК циклинов В1, В2, С, 01 и Т2. Вместе с тем, уровни экспрессии мРНК циклина І и протеина, который связывает кальциклин, а также киназы цикл деления клетки-2 (циклин-зависимой киназы-1) и транскрипционного фактора БМТБ увеличиваются в дефицитных по энзиму эндоплазматический ретикулум - ядро-1 клетках глиомы. Было также показано, что уровень экспрессии мРНК большинства исследованных генов также уменьшался в условиях гипоксии и при отсутствии в среде глюкозы или глютамина как у контрольных, так и в дефицитных по энзиму эндоплазматический ретикулум - ядро-1 клетках глиомы, но уровень экспрессии циклина 01 и І, а также ингибитора 1А циклин-зависимых киназ увеличивался в этих условиях. Таким образом, результаты этой работы убедительно свидетельствуют о зависимости уровня экспрессия большинства исследованных генов, которые кодируют синтез циклинов и циклин-зависимых протеинов, от функции сигнального энзима эндоплазматический ретикулум - ядро-1 как в нормальных условиях, так и при гипоксии, а также в условиях отсутствия глютамина и глюкозы, и которые возможно принимают участие в реакции адаптации клеток к стрессу эндоплазматического ретикулума, связанного с этими факторами.
Ключевые слова: экспрессия мРНК, циклины В1, В2, С, 01, Н, І и Т2, цикл деления клетки-2, клетки глиомы, эндоплазматический ретикулум - ядро-1, гипоксия, отсутствие глюкозы или глютамина в среде
