CC BY
0Effect of Hybrid Nanomaterial of Copper-Chitosan against Aflatoxigenic Fungi in Poultry Feed
Atef Abdelaziz Hassan1©, Noha Hassan Oraby1* , Manal Mohamad El-mesalamy2©, and Rasha Mahmoud Hamza Sayed-ElAhl ©
'Department of mycology and mycotoxins, Animal Health Research Institute (AHRI), Agriculture Research Center (ARC), Dokki, Giza, Egypt.
2Regional Laboratory, Zagazig, Animal Health Research Institute (AHRI), Agriculture Research Center (ARC), Giza, Egypt.
Corresponding author's E-mail: nohaoraby25@gmail.com
Received: 25 June, 2022 Accepted: 20 August, 2022
ABSTRACT
In the past decades, the application of nanotechnology indicated significant improvements in animal health. In the present work, 60 samples of poultry feeds were examined, including 20 samples for each yellow corn, soya bean, and processed feed. The prevalence of total fungi was reported as 100%, 95%, and 100% in yellow corn, soya bean, and processed feed, respectively. Toxin-producing Aspergillus flavus represented 75% of isolates from yellow corn, 88% from soya bean meal, and 50% from processed feed. Aflatoxins were found in 88%, 60%, and 80% of yellow corn, soya bean, and processed feed with mean levels of 18.5 ± 3.216.0 ± 4.08.3 ± 1.7 ppm, respectively. The copper nanoparticles embedded with chitosan were green synthesized using an eco-friendly method, and their antifungal activity was evaluated against aflatoxigenic mold that recovered from poultry feeds. However, the molecular detection of virulent genes of Aspergillus flavus (aflR gene) after their exposure to high doses of copper-chitosan nanoparticles (CuCh-NPs) 150 ^g/ml prevents aflR gene expression. The embedded chitosan with copper nanomaterial helps decrease their suspected toxicity to animals by reducing the used doses. Hence, the use of nanocomposites of nanomaterials with green benefits substances, such as chitosan, was the essential strategy of field application in veterinary.
Keywords: Aspergillus flavus, Chitosan, Copper nanoparticles, Nanotechnology, Poultry feed
JWPR
Journal of World's Poultry Research
2022, Scienceline Publication
J. World Poult. Res. 12(3): 157-164, September 25, 2022
Research Paper, PII: S2322455X2200018-12 License: CC BY 4.0
DOI: https://dx.doi.org/10.36380/jwpr.2022.18
INTRODUCTION
The use of nanotechnology is gaining more popularity in improving livestock health and productivity, especially in developing countries (Hassanen et al., 2019; Khalaf et al., 2019; Hassanen et al., 2020). Fungal infections caused by mycotoxigenic molds in food can cause significant carcinogenic effects on humans and animals (Hassan et al., 2022). Under adverse environmental conditions, aflatoxigenic molds produce aflatoxins (AFs) in food, and their consumption leads to several health problems (Adam et al., 2017; Qelik, 2020; Hassan et al., 2021). Given that the conventional methods of elimination, such as chemical antifungal, azoles, and antimycotoxins were proved inefficient, the elimination of AFs can be difficult and costly (Brunet et al., 2018; Di Mambro et al., 2019; Gintjee et al., 2020; Tiew et al., 2021). Consequently, recent studies have introduced new agents to eradicate toxin-producing pathogens (Singh et al., 2018). Earlier studies also assessed the advantages of using metal
nanomaterials over chemical agents in controlling the growth and viability of pathogens (Tran and Webster, 2011; Mohd Yusof et al., 2021). In the same vein, others used copper and zinc nanoparticles (Cu-NPs and Zn-NPs, respectively) for the degradation of fungi and mycotoxins to improve the safety of food production (Castro-Mayorga et al., 2020; Agrimonti et al., 2021; Konappa et al., 2021; Hassan et al., 2022). Therefore, the present study aimed to evaluate the prevalence of AFs in feed and the effect of copper-chitosan nanoparticles (CuCh-NPs) on inhibiting the fungi and aflatoxin-regulating genes using molecular detection.
MATERIALS AND METHODS
Samples
A total of 60 samples of poultry feeds were examined, including 20 samples from yellow corn, soya bean, and processed feed. Approximately 100 g from each sample was aseptically collected from poultry farms from
To cite this paper: Hassan AA, Oraby NH, El-mesalamy MM, and Sayed-ElAhl RMH (2022). Effect of Hybrid Nanomaterial of Copper-Chitosan against Aflatoxigenic Fungi in Poultry Feed. J. World Poult. Res., 12 (3): 157-164. DOI: https://dx.doi.org/10.36380/jwpr.2022.18
June to August 2021 in sterile polyethylene stretch film followed by an ensiling process, and it was stored in a dry aerobic place.
Isolation and identification of fungi species in samples
To begin, 5 g of each feed sample was separately transferred aseptically into sterile tubes, to which 45 ml of sterile distilled water was added, and 10-fold serial dilutions were prepared. Afterward, 1 ml of the previously prepared serial dilutions was inoculated separately into sterile Petri dishes plates and mixed with Dichloran-rose Bengal chloramphenicol agar or Sabouraud's dextrose agar (SDA) medium containing 0.05 mg of chloramphenicol/ml. The plates were left to solidify and dry. They were then incubated aerobically in the incubator at 25°C ± 1°C for 5 days. The plates were read during 2-5 days of incubation. The fungal cultures were separated based on morphological characteristics, including colony size (diameter, millimeter), texture, and surface. The fungal cultures were examined periodically during the incubation period. The culture characteristics and sporulation on different culture media were recorded after 7 days of incubation at 28°C. The morphological characteristics of each fungal isolate were determined using the light microscope (OPTO-EDU, China). The microscopic examination of fungal isolates was described after the fungal colonies were sporulated on the different culture media. For this purpose, small mycelia part from the center and edge of the growing colony was mounted onto a microscope slide using distilled water and covered by a cover slip. The characteristics of vegetative and reproductive structures, such as hyphal color and structures, spore shape, as well as spore size, were determined (ISO 21527/1, 2008; Pitt and Hocking, 2009).
Copper nanoparticles
Copper nanoparticles with the size of 50 nm were prepared at Biochemistry, Toxicology, and Feed Deficiency Department, Animal Health Research Institute, Egypt, and identified at the Central Laboratory of Elemental and Isotopic Analysis, Nuclear Research Centre, Egypt.
Synthesis and characterization of chitosan-copper nanoparticles
The method was based on a study by Du et al. (2009), indicating some changes as copper ions were
converted into nanosized material by mixing with a solution of acetic acid and chitosan, in which chitosan was dissolved in 1% (v/v) acetic acid to obtain a 0.3% (w/v) chitosan solution followed by refrigeration for 12 hours. The mixture was then centrifuged at 12000 rpm for 20 minutes at 4°C (Sigma Laborzentrifugen, Germany). The sediment was washed with distilled water, centrifuged again, and frozen until use. The freeze-dried CuCh-NPs were identified according to the method of Kaur et al. (2015). Their structures were detected by transmission electron microscopy (JEOL 2100F TEM instrument), and their infrared spectra were obtained using FTIR (Fourier transform infrared spectroscopy, Spectrum BX11, USA).
Preparation of tested isolates
The tested Aspergillus flavus (A. flavus) that were isolated from the present samples were subjected to Polymerase chain reaction (PCR) to identify their virulent genes. They were cultured on Sabouraud's dextrose broth medium and incubated at 25°C for 1-3 days for proper growth. The negative control was Fusarium species, while the positive control was standard isolates of A. flavus. On the other hand, the isolates of A. flavus were treated with CuCh-NPs under a septic condition in 100 ml flasks, then
4
20 ml of SD broth was added, and 0.2 ml of 10 spores was inoculated into the flask. The doses of treatments were leveled as low as 50 ^g/ml and as high as 150 ^g/ml for Cu-NPs. Then, the treated isolates were incubated at 25°C for 3 days and kept at 5-8°C until DNA extraction.
Genotypic evaluation of aflatoxigenic genes of Aspergillus flavus
DNA extraction and PCR amplification were performed according to Somashekar et al. (2004) and Fittipaldi et al. (2012). Genomic DNA of the strains was obtained using the genomic DNA Extraction Kit (QuickDNA Miniprep DNA purification) following the manufacturer's instructions. DNA concentration was determined spectrophotometrically at 260/230 nm using SPECTRO star Nano BMG LABTECH. DNA was stored at -20°C until PCR amplification for the target fragments of aflatoxin-producing and control fungal genes. Invitrogen Company prepared the PCR primer used in the current study (Table 1). The PCR reaction was performed in a Gradient Thermal cycler (1000 S Thermal cycler BioRad USA). The reaction mixture (total volume of 50 ^l) was 25 ^l Dream green PCR Mix (DreamTaq Green PCR Master Mix (2X) Thremoscientific Company, cat., No. K1081, USA), 5 ^l target DNA, 2 ^l of the primer
(containing 10 p mole/ pl), and the mixture was prepared by sterile Nuclease-free water to 50 pl. The PCR amplification conditions for the aflatoxin regulatory gene were 5 minutes for the initial step at 95°C, followed by 35 cycles at 95°C for 30 seconds, 56°C for 30 seconds, 72°C for 30 seconds, and a final extension step at 72°C for 10 minutes. Amplification products were electrophoresed in agarose gels in Tris-borate-EDTA (TBE) buffer with 1 pl of ethidium bromide/gel added for visualization under UV light (1.5% w/v, Agarose, Sigma, USA), using 100 bp DNA Ladder H3 RTU (Ready-to-Use) Cat. No. DM003-R500 from Gene Direx, Inc. Company, Litwania (Isalar et al. 2021).
Measurement of the minimum inhibitory concentration of CuCh-NPs against isolated Aspergillus flavus
The minimum inhibitory concentration (MIC) of
CuCh-NPs for aflatoxigenic A. flavus was detected by a broth micro-dilution method (CLSI, 2008) which starts by adding 900 pl of Sabouraud's dextrose (SD) broth in plastic test tubes, then inoculating with100 pl of A. flavus (104 spores/ml), then adding 100 pl of CuCh-NPs in 0, 50, 100, 150 pg/ml concentrations, then incubated for 2-5 days at 25-28°C. The MIC that suppressed the growth of pathogen cultures and the turbidity was checked every 24 hours. A UV-vis spectrophotometer detected the optical density of each tube content (SP-LUV759, China) set at 405 nm.
Statistical analysis
Re sults were expre s sed as me an ± SE. The statistical analysis was conducted using Statistical Package for Social Sciences Version 14, released in SPSS (2006).
Table 1. Primers for molecular identification of Aspergillus flavus
Virulence factor Target virulence gene Primers Amplicon size (Base pair) Annealing temperature (oC) Reference
Aflatoxin regulatory gene (aflR) of A. flavus aflR aflR-F AACCGCATCCACAATCTCAT aflR-RAGTGCAGTTCGCTCAGAACA 800 60 Somashekar et al. (2004)
RESULTS AND DISCUSSION
The results in Table 2 revealed that the prevalence of total fungi was 100% in yellow corn, 95% in soybean, and 100% in processed feed. Aspergillus flavus was the most prevalent mold of Aspergillus spp. with a total incidence of 45%. Aspergillus species were Aspergillus ochraceus, A. niger, A. candidus, A. fumigatus, and A. glaucus. The detected molds were Penicillium spp., Mucor spp., and Rhizopus spp., with a total incidence of 1.6%, 35%, and 33.3%, respectively. Candida albicans were found in 25% of samples. Similar findings were reported by FDA (2000), Hassan et al. (2020) who detected that A. flavus was the predominant species isolated from the feed. This proves that it requires several methods, such as using nanomaterials to inhibit fungal growth and activity from preventing human and animal diseases.
According to Table 3, the recovered A. flavus was used for the production of AFs, most of which were on yellow corn with the mean levels (750 ± 5.3 ppb) followed by processed feed (600 ± 6.1 ppb) and soya bean meal (170 ± 3.5 ppb). Toxin-producing A. flavus represented
75% of isolates from yellow corn, 88% from soya bean meal, and 50% from processed feed.
Generally, mycotoxins cause serious health hazards, especially in humid regions in developing countries, such as Egypt, due to the presence of AFs in feed (Nayak and Sashidhar, 2010; El-Nahass et al., 2019; Monda et al., 2020). Aflatoxins were detected in feed and feedstuffs by
El-Hamaky et al. (2016) at levels ranging from 170 to 750 ppb.
Table 4 shows that AFs were found in 88% of yellow corn with a mean level of 18.5 ± 3.2 ppm; 60% of soya beans with a mean level of 16.0 ± 4.0 ppm, and 80% of processed feed with a mean level of 8.3 ± 1.7 ppm. Herein, the obtained results of AFs were more than the safe permissible limits and can cause serious adverse effects on health by causing hepatic injury and cancers (FDA, 2000). The results agree with the previous findings of Frisvad et al. (2006), Nayak and Sashidhar (2010), and Hassan et al. (2020), who detected the dangerous hepatic-carcinogenic effects of AFs on rabbits and rats' livers.
Figure 1. The morphological characters of copper-chitosan nanoparticles (CuCh-NPs) under transmission electron microscopy (50 nm in size, A). UV-visible spectrophotometry of CuCh-NPs (the peak was at a range of 500-600 nm, B).
These results in Figure 1 are similar to the finding of Vanti et al. (2020). Due to the emergence of multidrug-resistant bacteria, conventional antibiotics are rendered ineffective (Hassan et al., 2020a), which led to the use of nanosized materials as an alternative to the traditional antimicrobial drug (Abinaya et al., 2016; Munir et al., 2020). Furthermore, nanosized particles were more effective than crude metals (El-Sayed and Kamel, 2020).
Today, several microbial infections, such as fungal and bacterial infections, have a multidrug resistance to conventional antibiotics, increasing the severity of the conditions (Hassan et al., 2020a). Hence, the search for new effective antimicrobial agents is required, and the nanosized materials showed significant success in this purpose as Zn-NPs and Cu-NPs (Sharma et al., 2018; Zakaria et al., 2020). The nanomaterials are more effective than crude materials and can be used for antibiotic and disease diagnosis (El-Sayed and Kamel, 2020). They may be supplemented in drinking water and feeds of broiler chickens to improve their health and immune status (Hassanen et al., 2020; Hassan et al., 2022).
As can be seen in Table 5, the increase in the CuCh-NPs concentration led to a decrease in optical density (OD), degree of turbidity (DT), and growth after treatment (GT). Therefore, the minimum inhibitory concentration (MIC) of CuCh-NPs against A. flavus was determined to be 150 ^g/ml. Nanomaterials can inhibit microbes by penetrating them and damaging their protein and DNA synthesis (Rudramurthy et al., 2016; Huang et al., 2020).
PCR detected the toxic gene (aflR) in A. flavus strains found in the samples. The efficacy of CuCh-NPs was evaluated the inhibiting that gene. Previous studies have also successfully detected aflR gene in A. flavus recovered from feed (Scherm et al., 2005; Cruz and Buttner, 2008; El-Hamaky et al., 2016). The exposure of A. flavus to high doses (150 ^g/ml) of CuCh-NPs significantly decreased the aflR gene expression (the efficiency percentage, the molecular weight of DNA, and the cycle threshold of the gene declined). Currently, the aflR gene expression in the case of treatment with a low dose (50 ug/ml) also resulted in similar activity but lower than the exposure to high doses of CuCh-NPs (Table 6). Hence, the exposure of virulent genes of toxigenic fungus to high amounts of nanomaterials resulted in the complete removal of genes and prevented drug resistance. The present study indicated the high efficiency of CuCh-NPs nanocomposites in suppressing the viability and growth of aflatoxigenic A. flavus. Several studies reported that Cu-NPs have antimicrobial potential against isolated fungi from clinical cases of animal disease and feeds (Sharma et al., 2018; Zakaria et al., 2020; Hassan et al., 2022). Currently, the composites of metals nanomaterials with green benefits materials, such as the chitosan effect, decrease the used dose of nanomaterials and overcome its suspected ecotoxicity. Hence, nanotechnology has significant progressive advancements in biotechnology and biomedicine related to human and animal science as it increases the safety of their health and production (Contera et al., 2020).
Table 2. Incidence of fungi species in poultry feeds
Fungal species Yellow corn (20) Soya bean meal (20) Processed feed (20) Total (60)
No. +ve % No. +ve % No. +ve % No. +ve %
Total fungi 20 100 19 95 20 100 59 98.3
Aspergillus species 17 85 14 70 15 75 46 76.6
Aspergillus flavus 8 40 9 45 10 50 27 45
Aspergillus ochraceus 3 15 2 10 4 20 9 15
Aspergillus niger 6 30 5 25 7 35 18 30
Aspergillus candidus 4 20 2 10 2 10 8 13.3
Aspergillus fumigatus 3 15 1 5 1 5 5 8.3
Aspergillus glaucus 1 5 0 0 0 0 1 1.6
Penicillium species 0 0 0 0 1 5 1 1.6
Mucor species 7 35 5 25 9 45 21 35
Rhizopus species 5 25 8 40 6 30 20 33.3
Geotrichum species 1 5 1 5 0 0 2 3.2
Candida albicans 5 25 6 30 4 20 15 25
No +ve: Number of positive
Table 3. Production of aflatoxins Bi by Aspergillus flavus isolated from poultry diets
Source of
Aspergillus flavus isolates
Incidence of toxigenic Aspergillus flavus isolated from poultry feeds
Total tested
No. +ve
Percentage
Produced aflatoxins (ppb)
Mean levels
Types
Biß2"
Yellow corn Soya bean meal Processed feed Total
8
9
10 27
6 5 5 16
75 88 50 59.2
750 i 5.3 170 i 3.5 600 i 6.1
B1, B2, G1 , G2 B1
The permissible limits of AFB1 were 15 ppb (WHO, 2002) and 20 ppb (FAO, 2004). No +ve: Number of positive.
Table 4. Levels of aflatoxins in poultry feeds
Feed types
Incidence of aflatoxins
No. +ve Percentage
Aflatoxins in samples (ppm)
Maximum Minimum Mean ± SE
Types of aflatoxins
Yellow corn Soya bean meal Processed feed
22 15 20
88 60 80
30.0 23.0 3.2
9.5 10.2
1.6
18.5 i 3.2 16.0 i 4.0 8.3 i 1.7
Bi, B2, GI,G2 BJ, B2, Gj, G2 Bi, B2, Gi, G2
The permissible levels of aflatoxin, according to WHO (2002) 15 ppb and FAO (2004) 20 ppb. SE: Standard Error, No +ve: Number of positive
Table 5. Optical density and degree of turbidity of treated Aspergillus flavus at a gradual concentration of CuCh-NPs
CuCh-NPs concentrations (^g/ml)
Aspergillus flavus
OD (a.u)
DT and GT
0 2.27 4+
50 1.65 3+
75 1.38 2+
100 1.08 1+
125 1.00 1+
150 0.60 0
Control antifungal: Fluconazole 20 ^g (Its OD: zero and turbidity: zero), OD: Optical density of treated spores at wavelength 405 nm, DT: Degree of turbidity of treated suspension, GT: Growth after Treatment. (a.u): absorbance unit
Table 6. Detection of aflR regulatory gene expression of Aspergillus flavus before and after treatment with CuCh-NPs
aflR gene expression at different doses of treatment
Aspergillus flavus Eff. (%) Mole C.T
Low dose High dose Low dose High dose Low dose High dose
Untreated controls 94.42 3.45 26.33
Treated with CuCh-NPs 32.46 13.63 0.01983 0.0198 26.62 23.26
Eff: Efficacy of aflR gene expression, Mole: Molecular weight of DNA (^g/ml), CT: Cycle Threshold CuCh-NPs: 50 ^g/ml (Low dose), 150 ^g/ml (High dose)
CONCLUSION
The presence of aflatoxigenic molds in animal feeds can produce AFs. The essential preventive and therapeutic activities of Cu-NPs embedded with chitosan have been evaluated against the aflatoxigenic mold. Additionally, CuCh-NPs could remove aflR genes of A. flavus when a higher dose of 150 pg/ml was used. The conjugation of Cu-NPs with chitosan reduced the used dosages of metal nanoparticles and avoided the toxic hazard of copper nanoparticles. Therefore, more studies are needed to evaluate the effects of copper chitosan nanoparticles at different doses in poultry diets.
DECLARATIONS
Acknowledgments
The authors would like to thank Prof. Dr. Mogda Kamel Mansour at Biochemistry, Toxicology and Feed Deficiency Department, Animal Health Research Institute, Egypt, for helping us prepare and characterize chitosan copper nanoparticles.
Funding
The authors received no funding for this study.
Authors' contributions
Noha Oraby, Rasha Sayed-ElAhl designed the research. All authors analyzed the data. Atef Hassan wrote the draft of the manuscript. Noha Oraby, Rasha Sayed-ElAhl and Manal El-mesalamy have revised the manuscript. All authors read and approved the last version of the manuscript for publishing in the present journal.
Competing interests
The authors declare that they have no competing interests.
Ethical consideration
The authors investigated ethical issues such as plagiarism, permission to publish, malfeasance, data falsification and/or fabrication, double publishing and/or submission, and redundancies.
REFERENCES
Abinaya C, Marikkannan M, Manikandan M, Mayandi J, Suresh P, Shanmugaiah V, Exstrum C, and Pearce JM (2016). Structural and optical characterization and efficacy of
hydrothermal synthesized Cu and Ag doped zinc oxide nanoplate bactericides. Materials Chemistry and Physics, 184: 172-182. DOI:
https://www.doi.org/10.1016/j.matchemphys.2016.09.039
Adam AMA, Tabana YM, Musa KB, and Sandai DA (2017). Effects of different mycotoxins on humans, cell genome and their involvement in cancer. Oncology Reports, 37(3): 1321-1336. DOI: https://www.doi.org/10.3892/or.2017.5424
Agrimonti C, Lauro M, and Visioli G (2021). Smart agriculture for food quality: Facing climate change in the 21st century. Critical Reviews in Food Science and Nutrition, 61(6): 971981. DOI: https://www.doi.org/10.1080/10408398.2020.1749555
Brunet K, Alanio A, Lortholary O, and Rammaert B (2018). Reactivation of dormant/latent fungal infection. Journal of Infection, 77(6): 463-468. DOI:
https://www.doi.org/10.1016/i.iinf.2018.06.016
Castro-Mayorga JL, Cabrera-Villamizar L, Balcucho-Escalante J, Fabra MJ, and Lopez-Rubio A (2020). Applications of nanotechnology in agry-food productions. Nanotoxicity, Chapter 15, pp. 319-340. DOI: https://www.doi.org/10.1016/b978-0-12-819943-5.00015-4
Qelik K (2020). The efficacy of mycotoxin-detoxifying and biotransforming agents in animal nutrition. Nanomycotoxicology, Chapter 12, pp. 271-284. DOI: https://www.doi.org/10.1016/B978-0-12-817998-7.00012-4
Clinical and Laboratory Standards Institute (CLSI) (2008). Reference method for broth dilution antifungal susceptibility testing of filamentous fungi: Approved standard, 2nd Edition. Clinical and Laboratory Standards Institute., Pennsylvania. pp. 19087-1898. Available at: https://clsi.org/media/1455/m38a2 sample.pdf
Contera S, Bernardino de la Serna J, and Tetley TD (2020). Biotechnology, nanotechnology, and medicine. Emerging Topics in Life Sciences, 4(6): 551-554. DOI: https://www.doi.org/10.1042/ETLS20200350
Cruz P and Buttner MP (2008). Development and evaluation of a real-time quantitative PCR assay for Aspergillus flavus. Mycologia, 100(5): 683-690. DOI:
https://www.doi.org/10.3852/08-022
Di Mambro T, Guerriero I, Aurisicchio L, Magnani M, and Marra E (2019). The yin and yang of current antifungal therapeutic strategies: How can we harness our natural defenses? Frontiers in pharmacology, 10: 80. DOI: https://www.doi.org/10.3389/fphar.2019.00080
Du WL, Niu SS, Xu YL, Xu ZR, and Fan CL (2009). Antibacterial activity of chitosan tripolyphosphate nanoparticles loaded with various metal ions. Carbohydrate Polymers, 75(3): 385-389. DOI:
https://www.doi.org/10.1016/ixarbpol.2008.07.039
El-Hamaky AM, Hassan AA, El Yazeed HA, and Refai MK (2016). Prevalence and detection of toxigenic A. flavus, A. niger and A. ochraceus by traditional and molecular biology methods in feeds. International Journal of Current Research, 8(1): 25621-25633. Available at:
https://www.iournalcra.com/sites/default/files/issue-pdf/12731.pdf
El-Nahass ES, Moselhy WA, Hassan NEHY, and Hassan AA (2019). Evaluation of the protective effects of adsorbent materials and ethanolic herbal extracts against aflatoxins hepatotoxicity in albino rats: Histological, morphometric, and immune histochemical study. Advances in Animal and Veterinary Sciences, 7(12): 1140-1147. DOI: http://www.doi.org/10.17582/iournal.aavs/2019/7.12.1140.1147
El-Sayed A and Kamel M (2020). Advanced applications of nanotechnology in veterinary medicine. Environmental Science and Pollution Research, 27: 19073-19086. DOI: https://www.//doi.org/10.1007/s11356-018-3913-y
Fittipaldi M, Nocker A, and Codon F (2012). Progress in understanding preferential detection of live cells using viability dyes in combination with DNA amplification. Journal of Microbiological Methods, 91(2): 276-289. DOI: https://www.doi.org/10.1016/i.mimet.2012.08.007
Food and drug administration (FDA) (2000). Toxicological principles for the safety assessment of food ingredients. IV.C.1. Short-term tests for genetic toxicity. Office of Food additive safety. Center for food safety and applied nutrition. Available at:
https://www.fda.gov/files/food/published/Toxicological-Principles-for-the-Safety-Assessment-of-Food-Ingredients.pdf
Frisvad JC, Thrane U, Samson RA, and Pitt JI (2006). Important mycotoxins and the fungi which produce them. Advances in Food Mycology, 571: 3-31. DOI: https://www.doi.org/10.1007/0-387-28391-9 1
Gintjee TJ, Donnelley MA, and Thompson GR (2020). Aspiring antifungals: Review of current antifungal pipeline developments. Journal of Fungi, 6(1): 28. DOI: https://www.doi.org/10.3390/iof6010028
Hassan AA, Mansour MK, Sayed-ElAhl RMH, El-Din HAT, Awad MEA, and Younis EM (2020). Influence of selenium nanoparticles on the effects of poisoning with aflatoxins. Advances in Animal and Veterinary Sciences, 8(2): 64-73. DOI:
http://www.doi.org/10.17582/iournal.aavs/2020/8.s2.64.73
Hassan AA, Mansour MK, El-Hamaky AM, Sayed-ElAhl RMH, and Oraby NH (2020a). Nanomaterials and nanocomposite applications in veterinary medicine. Multifunctional Hybrid Nanomaterials for Sustainable Agri-Food and Ecosystems, Chapter 24, pp. 583-638. DOI: https://www.doi.org/10.1016/B978-0-12-821354-4.00024-8
Hassan AA, El-Ahl RMH, Oraby NH, El-Hamaky AM, and Mansour MK (2021). Zinc nanomaterials toxicological effects and veterinary applications. Zinc-Based Nanostructures for Environmental and Agricultural Applications, Chapter 25, pp. 509-541. DOI: https://www.doi.org/10.1016/B978-0-12-822836-4.00019-7
Hassan AA, Sayed-ElAhl RMH, El-Hamaky AM, Mansour MK, and Oraby NH (2022). Copper nanoparticles: Synthesis, characterization, and its veterinary applications. Copper Nanostructures: Next-Generation of Agrochemicals for Sustainable Agroecosystems, Chapter 20, pp. 507-534. DOI: https://www.doi.org/10.1016/B978-0-12-823833-2.00016-7
Hassanen EI, Khalaf AA, Tohamy AF, Mohammed ER, and Farroh KY (2019). Toxicopathological and immunological studies on different concentrations of chitosan-coated silver
nanoparticles in rats. International Journal of Nanomedicine, 14: 4723-4739. DOI: https://www.doi.org/10.2147/IJN.S207644
Hassanen EI, Morsy EA, Hussien AM, Ibrahim MA, and Farroh KY (2020). The effect of different concentrations of gold nanoparticles on growth performance, toxicopathological and immunological parameters of broiler chickens. Bioscience Reports, 40(3): BSR20194296. DOI: https://www.doi.org/10.1042/BSR20194296
Huang W, Yan M, Duan H, Bi Y, Cheng X, and Yu H (2020). Synergistic antifungal activity of green synthesized silver nanoparticles and epoxiconazole against setosphaeriaturcica. Journal of Nanomaterial, 2020: e9535432. DOI: https://www.doi.org/10.1155/2020/9535432
Isalar OF, Ogbuji NG, Okungbowa FI, and Ataga AE (2021). Fungal contaminants associated with groundnut (arachis hypogaea) seeds. Journal of Bioinformatics and Systems Biology, 4(2021): 182-193. DOI:
http//www.doi.org/10.26502/jbsb.5107029
ISO (2008). Microbiology of food and animal feeding stuffs: Horizontal method for the enumeration of yeasts and molds. Available at: https://www.iso.org/standard/38275.html
Kaur P, Thakur R, Barnela M, Chopra M, Manuja A, and Chaudhury A (2015). Synthesis, characterization and in vitro evaluation of cytotoxicity and antimicrobial activity of chitosan-metal nanocomposites. Journal of Chemical Technology and Biotechnology, 90(5): 867-873. DOI: https://www.doi.org/10.1002/jctb.4383
Khalaf AA, Hassanen EI, Azouz RA, Zaki AR, Ibrahim MA, Farroh KY, and Galal MK (2019). Ameliorative effect of zinc oxide nanoparticles against dermal toxicity induced by lead oxide in rats. International Journal of Nanomedicine, 14: 7729-7741. DOI: https://www.doi.org/10.2147/IJN.S220572
Konappa N, Krishnamurthy S, Arakere UC, Chowdappa S, Akbarbasha R, and Ramachandrappa NS (2021). Nanofertilizers and nanopesticides: Recent trends, future prospects in agriculture. Advances in Nano-Fertilizers and Nano-Pesticides in Agriculture, Chapter 12, pp. 281-330. DOI: https://www.doi.org/10.1016/B978-0-12-820092-6.00012-4
Mohd Yusof H, Abdul Rahman NA, Mohamad R, Zaidan UH, and Samsudin AA (2021). Antibacterial potential of biosynthesized zinc oxide nanoparticles against poultry-associated foodborne pathogens: An in vitro study. Animals, 11(7): 2093.
DOI: https://www.doi.org/10.3390/ani11072093
Monda E, Masanga J, and Alakonya A (2020). Variation in occurrence and aflatoxigenicity of Aspergillus flavus from two climatically varied regions in Kenya. Toxins, 12(1): 34. DOI: https://www.doi.org/10.3390/toxins12010034
Munir MU, Ahmed A, Usman M, and Salman S (2020). Recent advances in nanotechnology-aided materials in combating microbial resistance and functioning as antibiotics substitutes. International Journal of Nanomedicine, 15: 7329-7358. DOI: http://www.doi.org/10.2147/IJN.S265934
Nayak S and Sashidhar RB (2010). Metabolic intervention of aflatoxin B1 toxicity by curcumin. Journal of Ethnopharmacology, 127(3): 641-644. DOI:
https://www.doi.org/10.1016/j.jep.2009.12.010
Pitt JI and Hocking AD (2009). Fungi and food spoilage, 3rd Edition. Springer., New York, pp. 519-388. DOI: https://doi.org/10.1007/978-0-387-92207-2
Rudramurthy G, Swamy M, Sinniah U, and Ghasemzadeh A (2016). Nanoparticles: Alternatives against drug-resistant pathogenic microbes. Molecules, 21(7): 836. DOI: https://www.doi.org/10.3390/molecules21070836
Scherm B, Palomba M, Serra DM, Marcello A, and Migheli Q (2005). Detection of transcripts of the aflatoxin genes aflD, aflO, and aflP by reverse transcription-polymerase chain reaction allows differentiation of aflatoxin-producing and non-producing isolates of Aspergillus flavus and Aspergillus parasiticus. International Journal of Food Microbiology, 98(2): 201-210. DOI:
https://www.doi.org/10.1016/i.iifoodmicro.2004.06.004
Sharma C, Kumar R, Kumar N, Masih A, Gupta D, and Chowdhary A (2018). Investigation of multiple resistance mechanisms in voriconazole-resistant Aspergillus flavus clinical isolates from a chest hospital surveillance in Delhi, India. Antimicrobial Agents and Chemotherapy, 62(3): e01928-17. DOI: https://www.doi.org/10.1128/AAC.01928-17
Singh A, Chhabra R, Sikrodia S, Shukla S, Sharda R, and Audarya S (2018). Isolation of E. coli from bovine mastitis and their antibiotic sensitivity pattern. International Journal of Current Microbiology and of Applied Science, 7(10): 1218. DOI: https://www.doi.org/10.20546/iicmas.2018.710.002
Somashekar D, Rati ER, and Chandrashekar A (2004). PCR-restriction fragment length analysis of aflR gene for differentiation and detection of Aspergillus flavus and
Aspergillus parasiticus in maize. International Journal of Food Microbiology, 93(1): 101-107. DOI: https://www. doi. org/10.1016/i.ii foodmicro .2003.10.011
Statistical Package for Social Science (SPSS) (2006). SPSS for windows Release 14.0.0. Standard Version, Copyright SPSS Inc., 1989-2006, All Rights Reserved, Copyright ® SPSS Inc. USA. Available at:
https://www. spss. software. informer. com/14. 0/
Tiew PY, Mac Aogain M, Ter SK, Aliberti S, Chalmers JD, and Chotirmall SH (2021). Respiratory mycoses in COPD and bronchiectasis. Mycopathologia, 186: 623-638. DOI: https://www.doi.org/10.1007/s11046-021-00539-z
Tran PA and Webster TJ (2011). Selenium nanoparticles inhibit Staphylococcus aureus growth. International Journal of Nanomedicine, 6: 1553-1558. DOI:
http://www.doi.org/10.2147/IJN.S21729
Vanti GL, Masaphy S, Kurjogi M, Chakrasali S, and Nargund VB (2020). Synthesis and application of chitosan-copper nanoparticles on damping off causing plant pathogenic fungi. International Journal of Biological Macromolecules. 156: 1387-1395. DOI:
https://www. doi. org/10.1016/i. iibiomac .2019.11.179
Zakaria A, Osman M, Dabboussi F, Rafei R, Mallat H, Papon N, Bouchara JP, and Hamze M (2020). Recent trends in the epidemiology, diagnosis, treatment, and mechanisms of resistance in clinical Aspergillus species: A general review with a special focus on the Middle Eastern and North African region. Journal of Infection and Public Health, 13(1): 1-10. DOI: http://www.doi.org/10.1016/i.iiph.2019.08.007
