CC BY
31
UDC 579.61 https://doi.org/10.15407.biotech13.05.087
EDIBLE FRUITS EXTRACTS AFFECT INTESTINAL MICROBIOTA ISOLATED FROM PATIENTS WITH NONCOMMUNICABLE DISEASES ASSOCIATED WITH CHRONIC INFLAMMATION
T. V. Meleshko1, 2 1 Uzhhorod National University, Department
O. V. Pallah1, 2 of Clinical Laboratory Diagnostics and Pharmacology,
R. O. Rukavchuk2 Faculty of Dentistry, Ukraine
L. S. Yusko1, 2 2 Uzhhorod National University,
N. V. Boyko1, 2 Research Development and Educational Centre
of Molecular Microbiology and Mucosal Immunology, Ukraine
E-mail: meleshkotv@ukr.net
Received 27.07.2020 Revised 08.10.2020 Accepted 31.10.2020
The aim of our study was to investigate the gut microbiota in patients with noncommunicable diseases associated with chronic inflammation, including obesity, type 2 diabetes, atherosclerosis, and cardiovascular disease as well as to find out potential ability of edible plants fruits extracts to inhibit the growth of selected conditionally pathogenic microorganisms.
Limited clinical trial was performed and gut microbiota analysis was done using routine methods and qPCR. The antibacterial properties of edible plants fruits in relation to the selected potentially pathogenic microorganisms were studied.
The composition of the intestinal microbiota of obese patients was characterized by an increase in the number of Enterococcus spp. and Lactobacillus spp. along with a decrease in the amount of Escherichia coli. Decreases in E. coli and lactobacilli were observed in patients with type 2 diabetes. In atherosclerosis, an increase in streptococci, enterococci, and enterobacteria was observed, whereas in patients with cardiovascular disease there was an additional increase in staphylococci and candida along with a decrease in E. coli. Decreases in Bifidobacterium spp., Bacteroides spp., Roseburia intestinalis and Akkermansia muciniphila were observed in patients of all groups. The growth of Klebsiella spp. was inhibited by red currant (Ribes rubrum) and plum (Prunus domestica) extracts; Enterobacter spp. — cherry (Prunus avium) extract; Proteus spp. — extracts of blueberry (Vaccinium myrtillus) and dogwood (Cornus mas); Staphylococcus spp. — the extracts of black currant (Ribes nigrum), cherry (Prunus avium), plum (Prunus domestica), jostaberry (Ribes nigrum x Ribes divaricatum x Ribes uva-crispa), cherry plum (Prunus cerasifera) and dogwood (Cornus mas).
The obtained data can be used for early diagnosis of noncommunicable diseases and for their prevention with the help of personalized nutrition.
Key words: obesity, type 2 diabetes mellitus, atherosclerosis, cardiovascular diseases, gut micro-biota, edible plants fruits.
According to the World Health Organization (WHO), non-communicable diseases (NCDs) are chronic diseases that are not transmitted from person to person, have a long course, and progress slowly. In the late twentieth century, NCDs turned into a global epidemic and one of the greatest threats to human life and health. According to the WHO, 40 million people die annually from NCDs, which accounts for 70% of all
deaths in the world [1]. NCDs result from a combined influence of genetic, physiological, environmental, and behavioral factors [2].
Studies of changes in the intestinal microbiome and its role in the occurrence of NCDs have become extremely relevant in recent years [3]. Microbiome is part of human physiology and is significantly involved in a wide range of vital physiological processes, including energy homeostasis and metabolism,
synthesis of vitamins and other important nutrients, endocrine signaling, prevention of colonization by pathogens, regulation of immune function, and metabolism of xenobiotics, carcinogens, and other harmful compounds [4].
Persistent low-grade inflammatory response underscores metabolic syndrome and is a risk factor for cardiovascular diseases (CVDs) [5, 6]. Inflammatory markers are associated with obesity and the risk of obesity-related CVDs [7]. Perturbation of intestinal microbiota and changes in gut permeability are triggers for the chronic inflammatory state [8]. "Metabolic endotoxaemia" is a term used to describe a link between gut bacteria, endotoxins, and their circulating levels, with inflammatory-induced obesity and metabolic diseases linking it to CVDs [9].
Some research studies [10] demonstrated that intestinal microbiota changes related to obesity lead to threshold inflammation. In obese people, intestinal microbiota changes stimulate the absorption of monosaccharides due to the increased number of capillaries in the small intestine epithelium [11] and significantly increase the ability to obtain more energy from food by increasing the number of microorganisms capable of fermenting indigestible carbohydrates in the colon [12, 13]. Obesity is a major risk factor for the development of type 2 diabetes (T2D), which leads to the destruction of insulin receptors and causes resistance to insulin. In turn, patients with diabetes also tend to suffer from comorbidities, such as hypertension and dyslipidemia, which further accelerates the atherosclerotic process, and, therefore, such patients have an extremely high cardiovascular risk [14]. Atherosclerosis is a major risk factor for CVDs assuming accumulation of cholesterol and macrophages on arteries walls, thus contributing to the formation of atherosclerotic plaques [15]. Recent studies suggest that intestinal microbiota disruption may also enhance development of atherosclerosis and CVDs [16, 17].
In our opinion, among numerous NCDs, it is necessary to distinguish a group of diseases directly relating to changes in the microbiome and the main trigger of which is chronic inflammation, that is obesity, T2D mellitus, atherosclerosis, and CVDs.
Nutrition is the most important factor that regulates gut microbiota composition. Personalized nutrition is one of the most effective approaches for prevention and treatment of NCDs [18]. The edible plants'
fruits which are characterized by high biologically active compounds (BAC) contents and ability to stimulate the growth of beneficial microorganisms and inhibit the growth of conditionally pathogenic microorganisms could be perspective components for personalized nutrition.
Therefore, the aim of our research was to study intestinal microbiota in patients with NCDs related to chronic inflammation, namely obesity, T2D mellitus, atherosclerosis, and CVDs as well as to find out potential ability of edible plants fruits extracts to inhibit the growth of selected conditionally pathogenic microorganisms.
Materials and Methods
Participants and study design
In order to study gut microbiota in patients with NCDs related to chronic inflammation, we performed a limited clinical case study, in which four groups were formed: 1 — patients with obesity; 2 — patients with type 2 diabetes; 3 — patients with atherosclerosis; 4 — patients with cardiovascular diseases. In order to achieve this goal, we examined 10 people from each group.
The inclusive criteria for obesity were the value of the body mass index (BMI), which exceeds (>) 30 kg/m2 [19]; signed informed consent to participate in the study. Exclusion criteria: smoking, alcohol or drug use, diabetes mellitus, CVDs, clinically significant kidney or liver disease (or other organs and organ systems), acute inflammatory diseases at the time of examination, cancer; significant lifestyle changes, mainly of dietary habits and physical activity in the period shorter than 6 months.
Patients with T2D were selected according to the criteria typical of this nosology [20]: fasting plasma glucose > 6.1 mmol/l; impaired glucose tolerance — two hours after the oral dose a plasma glucose 7.8-11.1 mmol/l; glycated hemoglobin (HbA1c) > 6.5%; signed informed consent to participate in the study. Exclusionary criteria were smoking, alcohol, or drug abuse; pregnancy; an unstable medical status; significant lifestyle changes, mainly of dietary habits and physical activity in the period shorter than 6 months. No participants had clinically significant cardiovascular, renal or liver disease or a history of cancer.
Inclusion criteria for atherosclerosis were [21]: patients with a BMI in the range of normal weight; low cardiovascular risk (SCORE < 1%); total cholesterol level below 8 mmol/l; total
triglycerides levels below 2.3 mmol/l; signed informed consent to participate in the study. Exclusion criteria: patients receiving lipid-lowering therapy (statins, ezetimibe, etc.) or patients who do not meet the minimum period of 3 months of discontinuation of therapy; the lipid profile outside the inclusion criteria; diabetes mellitus; SCORE > 1%; proven secondary causes of dyslipidemia; presence of manifest cardiovascular system disease in the form of coronary artery disease, past stroke, TIA, MI, etc.; presence of acute diseases, chronic deterioration, or presence of infection, which may distort the laboratory parameters; significant lifestyle changes, mainly of dietary habits and physical activity in the period shorter than 6 months.
The following inclusion criteria were used to select patients with CVDs: diagnosed coronary heart disease, stroke, carotid artery stenosis [22]; SCORE >5%; hyperlipidemia; signed informed consent to participate in the study. Exclusion criteria were smoking, alcohol, or drug abuse; pregnancy; an unstable medical status; clinically significant renal or liver disease, acute inflammatory diseases at the time of examination or a history of cancer; significant lifestyle changes, mainly of dietary habits and physical activity in the period shorter than 6 months.
The Transcarpathian Regional Clinical Cardiology Dispensary was the place of inpatient examination of patients diagnosed with atherosclerosis and CVDs, and for patients with obesity and T2D — the therapeutic department of the Mukachevo Central District Hospital.
According to the conclusions of the Commission on Biomedical Ethics (Protocol №6/1 of 26.05.2020), all studies were performed in compliance with the basic provisions of the Good Clinical Practice (GMP) (1996), Convention on Human Rights and Biomedicine of the Council of Europe (04.04.1997), the World Medical Association Declaration of Helsinki — Ethical Principles for Medical Research Involving Human Subjects (1964-2013), and the orders of the Ministry of Health of Ukraine №690 of 23.09.2009 and №616 of 03.08.2012, in which a person is an object of research. All patients gave informed consent to participate in the study.
Analysis of gut microbiota
In order to study gut microbiota the faecal samples were diluted with pre-reduced phosphate-buffered saline (PBS), then the ten-
fold serial dilution of samples was performed in PBS and plated correspondingly on the following nutrient media: Mitis Salivarius Agar, Bile Esculin Agar, Mannitol Salt Agar, Endo Agar, Bismuth Sulphite Agar, HiCrome Clostridial Agar, Sabouraud Dextrose Agar, Lactobacillus MRS Agar, Bifidobacterium Agar, Bacteroides bile esculin agar, Propionibacter Isolation Agar, L.D. Esculin HiVegTM Agar (manufactured by HiMedia Laboratories, India), UriSelect™ 4 Medium (Bio-Rad Laboratories, Inc, USA), and Blaurock semi-liquid modified hepatic medium (manufactured by Liofilchem, Italy). Identification of isolated microorganisms was performed using biochemical test systems ANAERO-23, ENTERO-24, NEFERM-test, Candida-23, STAPHY-16, and STREPTO test 24 (Erba Lachema s.r.o., Czech Republic).
Real-time polymerase chain reaction (qPCR) was performed on an AriaMx instrument (manufactured by Agilent Technologies, USA) using specific primers (Table 1). Isolation of bacterial DNA was performed using the ZymoBIOMICS DNA Mini Kit (Zymo Research, USA) according to the instructions for use. The concentration of isolated DNA in the samples was checked on a DeNovix DS-11 FX + spectrophotometer/ fluorometer (DeNovix Inc., USA).
Extracts preparation
Using Grindomix™ electric mixer, we obtained native homogenates of the following edible plants fruits (grown in the mountainous regions of Zakarpattia): Ribes rubrum (red currant), Prunus avium (sweet cherry), Prunus x domestica (plum), Ribes x nidigrolaria (jostaberry), Vaccinium myrtillus (blueberry), Ribes nigrum (black currant), Prunus cerasifera (alycha) and Cоrnus mas L. (cornelian cherry). The obtained homogenates were filtered through nylon nanofilters with a pore width of 44 pm (BD Falcon, USA).
We studied the antibacterial properties of the above-mentioned edible plants fruits in relation to the selected microorganisms such as Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, Klebsiella oxytoca, Proteus mirabilis, Pseudomonas aeruginosa, Streptococcus pyogenes, Staphylococcus aureus, Enterococcus faecalis, Candida albicans by culturing them in extracts obtained from these edible plants fruits [23]. The initial concentration of the selected bacterial strains was 1.5x108 CFU/ml. After 24, 48 and 72 hour of their co-incubation the ten-fold serial dilution of samples was performed and plated
Table 1. Primers used in the present study for real-time PCR analysis
Target group Primer sequence Reference
Bacteroides spp. GAAGGTCCCCCACATTG CGCKACTTGGCTGGTTCAG [23]
Faecalibacterium prausnitzii GGAGGAAGAAGGTCTTCGG AATTCCGCCTACCTCTGCACT [24]
Roseburia intestinalis GCGGTRCGGCAAGTCTGA CCTCCGACACTCTAGTMCGA [25]
Аkkermansia muciniphila CAGCACGTGAAGGTGGGGAC CCTTGCGGTTGGCTTCAGAT [26]
Bifidobacterium spp. GGGTGGTAATGCCGGATG TAAGCCATGGACTTTCACACC [27]
correspondingly on an appropriate nutrient medium. The test cultures of microorganisms without edible plants fruits extracts were the control in the study.
Data analysis
Statistical analyses were performed using the statistical program Origin 2019 (OriginLab Corporation, USA). All data are presented as median and interquartile range or the mean ± SD. Nonparametric comparisons were done using multiple comparisons Kruskal-Wallis ANOVA with Dunn's Test as post-hoc analysis. P values < 0.05 were considered statistically significant. Normally disturbed date were compared using Student's t-test.
Results and Discussion
Among the coccal microorganism forms of the intestinal microbiota of obese patients, there was a significant increase in the amount of enterococci, while the amounts of streptococci and staphylococci were within the norm. The level of bacteria of the genera Enterococcus spp., Streptococcus spp., and Staphylococcus spp. in the gut microbiota of patients with T2D was within the norm. In patients with atherosclerosis, intestinal microbiota demonstrated an increase in the amounts of enterococci and streptococci along with the normal value of staphylococci amount. Under CVDs, patients showed an increase in the amounts of bacteria of the genera Enterococcus spp., Streptococcus spp., and Staphylococcus spp. in gut microbiota (Fig. 1).
Analysis of the obtained data reveals that an significant increase in the amount of staphylococci within intestinal microbiota was characteristic only of the group of patients
with CVDs, while an increase in the amount of streptococci was observed in patients with atherosclerosis and CVDs. An increase in the amount of enterococci was observed in patients with obesity, atherosclerosis, and CVDs. Therefore, an increase in the amount of coccal microorganism forms, namely Enterococcus spp., Streptococcus spp., and Staphylococcus spp., within gut microbiota may indicate the development of atherosclerosis and CVDs.
In the intestinal microbiota of patients with obesity and T2D, Enterobacteriaceae demonstrated a significant decrease in the amount of normally fermenting Escherichia coli at the normal concentration of Proteus vulgaris, Klebsiella spp., and Enterobacter spp. In patients with atherosclerosis, gut microbiota demonstrated a significant increase in the amount of Klebsiella spp. and Enterobacter spp., while the amounts of E. coli and P. vulgaris slightly exceeded the norm. In the intestinal microbiota of patients with CVDs, there was an increase in the amounts of Enterobacter spp. and P. vulgaris, a decrease in the value of E. coli, and a normal amount of Klebsiella spp. (Fig. 2).
According to the data obtained in the study, an increase in the amount of Klebsiella spp. was characteristic only of patients with atherosclerosis, while an increase in the amounts of P. vulgaris and Enterobacter spp. was observed in patients with atherosclerosis and CVDs. The concentration of E. coli was below the norm in patients with obesity, T2D, and CVDs, but in patients with atherosclerosis there was a slight excess of this bacterium. Given the above, an increase in the amount of enterobacteria, especially Klebsiella spp. and Enterobacter spp., indicates the development of atherosclerosis.
10
8-
5 S ~ o 6
C Lira cj
R b>
2 S
u
S o
2 -
Entenxoccus spp.
Obesity T2D
Atherosclerosis CVD
- e
10
- 2
Streptococcus spp, Staphylococcus spp.
Fig. 1. The patients gut microbiota composition: coccal microorganisms (n = 10)
Bar graph showing the median values and interquartile range * represent significantly different values (P < 0.05)
<=
o
12
10-
<D <J
sz a (j ,__
E
OJ
c Liai CJ
F-TS
I *
u —
E B d
■o
<U
6-
4-
I I
Obesity TZD
Atherosclerosis CVD
I-1
- 10
12
- 6
E. coli
P. vulgaris Klebsiella spp. Enterobacter spp.
Fig. 2. The patients gut microbiota composition: Enterobacteriaceae (n = 10)
Bar graph showing the median values and interquartile range * represent significantly different values (P < 0.05)
Anaerobic and facultative-anaerobic gut microbiota of obese patients was characterized by an increase in the value of Lactobacillus spp., normal values of Clostridium spp., Faecalibacterium prausnitzii and yeastlike fungi of the genus Candida, as well as a decrease in the levels of Bifidobacterium spp., Bacteroides spp., Roseburia intestinalis, and Аkkermansia muciniphila.
In the intestinal microbiota of patients with T2D, there was a decrease in the amounts of Bifidobacterium spp., Lactobacillus spp., Bacteroides spp., F.prausnitzii, R. intestinalis, and A. muciniphila, while the amounts of yeasts of the genus Candida and Clostridium spp. were within the norm. In the intestinal microbiota of patients with atherosclerosis and CVDs, there was a decrease in the values of Bifidobacterium spp., Bacteroides spp., F. prausnitzii, R. intestinalis, and A. muciniphila, as well as normal values of Lactobacillus spp., Clostridium spp. An significant increase in the amount of Candida spp. within intestinal microbiota was characteristic only of the group of patients with CVDs (Fig. 3 and Fig. 4).
While analyzing the data obtained, we could see that an increase in the concentration of lactobacilli within gut microbiota is observed in obese patients, a decrease in the concentration of Lactobacillus spp. is characteristic of the microbiota of patients with T2D, while in patients with atherosclerosis and CVDs the amount of lactobacilli is within the norm. Intestinal microbiota of patients of all groups was characterized by normal amounts of Clostridium spp., while the normal concentration of F. prausnitzii was observed only in patients with obesity. Decrease in the amounts of Bifidobacterium spp., Bacteroides spp., R. intestinalis, and A. muciniphila within gut microbiota was observed in patients of all nosological groups.
In previous studies, we obtained data demonstrating the content of biologically active compounds of selected edible plants fruits and their potential ability to stimulate the growth of lactic acid bacteria [29]. Here we present the results of the studied effect of edible plants fruits extracts on commensal, beneficial, potentially pathogenic bacterial strains (Table 2).
According to the data obtained (Table 2), the Ribes rubrum extract totally inhibited the growth of K. pneumoniae, K. oxytoca, and P. aeruginosa on 48 h of co-cultivation as well as S. aureus on 72 h of co-cultivation. The extract of Ribes nigrum totally inhibited growth of
S. aureus after 48 h of co-cultivation and K. pneumoniae, K. oxytoca, and P. aeruginosa on 72 h of co-cultivation. The Prunus avium extract totally inhibited growth of E. cloacae and S. aureus on 48 h of co-cultivation as well as K. pneumoniae, K. oxytoca, P. aeru-ginosa, E. faecalis, and P. mirabilis on 72 h of co-cultivation. The growth of such bacterial strains as K. pneumoniae, K. oxytoca, S. aureus, and C. albicans was totally inhibited by Prunus domestica extract on 48 h of co-cultivation, while the strains of E. coli, E. cloacae, P. mirabilis, P. aeruginosa, and S. pyogenes strains were totally inhibited after 72 h of co-cultivation. The Ribes nigrum x Ribes divaricatum x Ribes uva-crispa extract totally inhibited growth of P. aeruginosa and S. aureus after 48 h of co-cultivation and E. cloacae after 72 h of co-cultivation. The extract of Vaccinium myrtillus on 48 h of co-cultivation totally inhibited growth of P. mirabilis as well as s K. pneumoniae, K. oxytoca, and S. aureus after 72 h of co-cultivation. The growth of P. aeruginosa and S. aureus was totally inhibited by Prunus cerasifera extract on 48 h of co-cultivation, while such bacterial strains as E. cloacae, K. pneumoniae, K. oxytoca, P. mirabilis, E. faecalis, and C. albicans totally inhibited after 72 h of co-cultivation. The Cornus mas extract totally inhibited growth of P. mirabilis, S. aureus, and C. albicans after 48 h of co-cultivation.
Analyzing the data obtained in these study, it can be concluded that extracts of Ribes rubrum and Prunus domestica can be used for inhibition of the growth of Klebsiella spp.; the extract of Prunus avium can be used for inhibition of Enterobacter spp. growth; the extracts of Vaccinium myrtillus and Cornus mas are effective growth inhibitors of Proteus spp.; the extracts of Prunus domestica and Cornus mas can be used for growth inhibition of Candida spp.; the extracts of Ribes nigrum, Prunus avium, Prunus domestica, Ribes nigrum x Ribes divaricatum x Ribes uva-crispa, Prunus cerasifera and Cornus mas are effective growth inhibitors of Staphylococcus spp.
Current research studies consider a potential role of gut microbiota in the development of obesity and related comorbidities. Gut microbiota can influence energy extraction from food, lipid metabolism, immune response, and endocrine functions and its profile has shown differences between obese and non-obese subjects [30]. Our study revealed that intestinal microbiota of obese patients was characterized by a sharp increase in the amount of enterococci and a decrease
d
o
•
<z
L
<D
o
!=
o
(J
E Ol
ZJ
[i _L_
TO o
O) L_
1 CJ) o
(J —
E
Hi—
o
c
<15
T3
<u
12
10-
8 -
6-
2-
Obesity T2D Atherosclerosis CVD
12
- 10
-8
- 6
-2
Candida spp. Bifidobacterium spp. Lactobacillus spp. Clostridium spp.
Fig. 3. The patients' gut microbiota composition: Anaerobes and facultative-anaerobes (n = 10)
Bar graph showing the median values and interquartile range * represent significantly different values (P < 0.05)
14
<=
o
12-
<U <J
sz a
u .__
E
UJ
'E u-
OJ (J
I *
u —
E B d
■o
<U
10
8 -
4-
2-
i
Obesity T2D
Alherosderosls CVD
14
- 12 - 10 - 8 6 -4 -2
0
Becteroides spp. F. prausnitzii Roseburia intestinalis A. muciniphila
Fig. 4. The patients' gut microbiota composition: obligate anaerobes (n = 10) Bar graph showing the median values and interquartile range * represent significantly different values (P < 0.05)
Table 2. Biological influence of edible plants fruits extracts on growth of selected microorganisms in dynamics
No Tested extract Tested microorganism Co-cultivation, hours and number of cultured microorganisms, CFU/ml
24 h 48 h 72 h
Escherichia coli (2.6±0.58)-108 (4.67±0.57)-107 (3.67±0.57)-106
Enterobacter cloacae (3±1)-109 (4±1.73)-106 (2.67±1.53)-104
Klebsiella pneumoniae (4.33±1.52)-104* 0 0
Klebsiella oxytoca (8±1)-103* 0 0
1 Ribes rubrum Proteus mirabilis (6.33±1.52)108 (4.33±0.57)-106 (3.3±1.15)105
Pseudomonas aeruginosa (7±1)-105* 0 0
Streptococcus pyogenes (6.67±1.52)-108 (5±2)-106 (1±0.57)-104
Staphylococcus aureus (7.33±0.57)-108 (6±1)-104* 0
Enterococcus faecalis (4.33±1.52)-107 (3±1.73)-106 (1.67±0.57)-105
Candida albicans (6±1)-109 (4±1)-108 (2.67±0.57)-107
Escherichia coli (6.67±1.53)-107 (5.33±0.57)105 (3.33±1.53)102
Enterobacter cloacae (7.33±1.15)-108 (6.33±2.08)105 (3.66±2.51)102
Klebsiella pneumoniae (8.66±1.53)107 (5±2.65) 103* 0
Klebsiella oxytoca (6.33±1.15)108 (4.66±2.52)-104* 0
Proteus mirabilis (8.33±2.89)-108 (3 ±1.73)-106 (4 ±2)-106
2 Ribes nigrum Pseudomonas aeruginosa (6.33±3.51)107 (5 ±1)-103* 0
Streptococcus pyogenes (7.66±1.53)-108 (3.67±2.08)-106 (5.67±1.53)-106
Staphylococcus aureus (6 ±2)-105* 0 0
Enterococcus faecalis (7 ±1)-107 (6.33±1.15)105 (7.33±1.15)-103
Candida albicans (3.33±1.52)108 (4.67±2.08)-106 (6.33±0.57)106
Escherichia coli (3.67±1.15)-108 (3.67±1.15)-106 (7±1)-106
Enterobacter cloacae (7.33±1.15)-103* 0 0
Klebsiella pneumoniae (6.67±1.52)-107 (4±1)-103* 0
Klebsiella oxytoca (7.33±1.52)-107 (6±1.72)-104* 0
Proteus mirabilis (7±1)-108 (2.33±0.58)-104* 0
3 Prunus avium Pseudomonas aeruginosa (8.66±0.58)-107 (5.3±1.53) 104* 0
Streptococcus pyogenes (5±2)-107 (2.67±1.15)-106 (1.33±0.58)-106
Staphylococcus aureus (7.66±1.52)-105* 0 0
Enterococcus faecalis (6.33±1.52)107 (4.33±1.15)-104 0
Candida albicans (4±1.73)-108 (5.67±2.51)-106 (3.33±1.52)105
Escherichia coli (7±1)-108 (5.3±1.52)-103 0
4 Prunus x do- Enterobacter cloacae (3±1.73)-105* (4.67±2.08)-102* 0
mestica Klebsiella pneumoniae (8.66±0.57)-104* 0 0
Klebsiella oxytoca (6.66±0.57) 104* 0 0
Table 2. (Continued)
1 2 3 4 5 6
Proteus mirabilis (8±1.73)-108 (7.67±1.52)-104* 0
Pseudomonas aeruginosa (5±2)-109 (6.66±2.08)104 0
Streptococcus pyogenes (5.33±3.21)106 (6.33±2.51)103 0
Staphylococcus aureus (8.33±0.57)-105* 0 0
Enterococcus faecalis (5.66±1.52)106 (4±2.64)-106 (2±1)-105
Candida albicans (7±2.65)-105* 0 0
Escherichia coli (4.33±3.51)-108 (3±1.73)-107 (7±2.64)-106
Enterobacter cloacae (6.67±2.51)-105* (5±1.73)-102* 0
Klebsiella pneumoniae (3±2)-108 (4.66±2.08)-107 (3.33±0.57)107
Klebsiella oxytoca (4±1)-108 (5.67±2.08)-108 (3.66±1.52)107
5 Ribes x nidi- Proteus mirabilis (7.66±1.52)-108 (8.33±1.52)-107 (5.33±0.57)-106
grolaria Pseudomonas aeruginosa (8±2.65)-104* 0 0
Streptococcus pyogenes (6.33±1.53)108 (7.66±1.53)105 (4.66±1.53)104
Staphylococcus aureus (9.66±0.57) 104* 0 0
Enterococcus faecalis (2.67±1.52)-107 (4±1)-107 (3.33±1.53)105
Candida albicans (7±1)-108 (6.33±2.08)106 (5.66±1.52)104
Escherichia coli (8±1.73)-108 (5±1)-108 (4.33±1.53)-108
Enterobacter cloacae (7.33±1.53)-108 (8.67±1.53)-108 (5 ±1)-107
Klebsiella pneumoniae (9 ±1)107 (8.33±0.57)-104* 0
Klebsiella oxytoca (7±2.65)-108 (6.33±2.08) 105* 0
6 Vaccinium Proteus mirabilis (9.33±1.15)104* 0 0
myrtillus Pseudomonas aeruginosa (7.33±0.57)-109 (6±1.73)-108 (3.66±0.58)107
Streptococcus pyogenes (9.67±0.58)-108 (5.67±3.05)107 (5±1)-107
Staphylococcus aureus (5.33±0.58)108 (6.33±1.53)106 0
Enterococcus faecalis (8.33±0.58)-108 (6.67±2.52)-106 (5.67±1.52)-106
Candida albicans (8±1)-108 (7±1.73)-106 (5.67±2.08)-105
Table 2. (End)
1 2 3 4 5 6
Escherichia coli (5.33±2.89)-108 (3.33±4.04)105 (6.33±2.08)102
Enterobacter cloacae (8±3.46)-105* (7.33±2.89)-102* 0
Klebsiella pneumoniae (6.67±2.31)-108 (4±2)-104* 0
Klebsiella oxytoca (6±3.46)107 (7.33±3.79)-103 0
7 Prunus Proteus mirabilis (5.67±1.15)-107 (4.67±1.52)-105* 0
cerasifera Pseudomonas aeruginosa (8 ±2)-103* 0 0
Streptococcus pyogenes (6.33±0.57)108 (8±1.73)-106 (5.33±2.31)104
Staphylococcus aureus (5±2.65) 103* 0 0
Enterococcus faecalis (7±3)-107 (6.66±1.53)105 0
Candida albicans (4.66±3.06)107 (7±2.65)-104* 0
Escherichia coli (6±4.36)107 (5.33±1.53)106 (4.33±0.57)-104
Enterobacter cloacae (6.33±1.53)108 (8±1)-108 (5±3)-107
Klebsiella pneumoniae (6±1)-107 (4.33±2.51)-106 (6.67±1.52)-104
Klebsiella oxytoca (5±1.73)-108 (7±1)-107 (7.67±2.52)-105
8 Cornus mas Proteus mirabilis (3.33±1.52)107 0 0
Pseudomonas aeruginosa (6.33±2.31)107 (6±1.73)-105 (6.67±1.52)-105
Streptococcus pyogenes (4.33±1.52)-107 (4.67±1.52)-105 (5.33±2.08)-104
Staphylococcus aureus (7.67±1.15)-105* 0 0
Enterococcus faecalis (5.33±1.52)105 (3.67±2.08)-106 (6±2)-106
Candida albicans (4.67±3.06)-104* 0 0
Note: * the data were statistically significant as compared with the control ^ < 0.05);
concentration of E. cloacae, K. pneumoniae, K. oxytoca, P. mirabilis, P. aeruginosa, C. albicans on 24 h of cultivation — 2-109 CFU/ml, 48 h — 1.5107 CFU/ml, 72 h — 1105 CFU/ml as well as concentration of E. coli, S. pyogenes, S. aureus, E. faecalis, C. albicans on 24 h of cultivation — 1.5108 CFU/ml, 48 h — 2.5105 CFU/ml, 72 h — 2-104 CFU/ml were used as a control.
in the amounts of normally fermenting E. coli and bifidobacteria, which are early diagnostic markers of metabolic disorders [31].
A close relationship between the gut microbe-dependent production of trimethylamine-N-oxide (TMAO), derived from specific dietary nutrients, such as choline and carnitine, and future cardiovascular events has been widely
recognized [32]. Trimethylamine (TMA), which is produced by gut microbial enzymes TMA lyases, is a precursor of TMAO. As different gut microbial compositions generate different levels of TMAO [33], higher blood TMAO levels and an increased development of atherosclerosis and CVDs risk can be attributed to a TMA-producing microbiome harboring TMA lyases. Our research results
demonstrate that intestinal microbiota of patients with atherosclerosis and CVDs is characterized by an increase in the amounts of Streptococcus spp., E. coli, and Klebsiella spp. This is confirmed by the fact that these bacteria are able to produce TMA [34].
One of the most important metabolic activity of gut microbiota is the production of non-gaseous SCFAs (acetate, propionate, and butyrate), through fermentation of microbiotaaccessible, complex carbohydrates (e.g., oligosaccharides, resistant starch, and plant cell wall materials) [35]. Butyrate plays a significant role in the maintenance of intestinal epithelial cell integrity with important functions in the prevention of 'leaky gut' associated with diabetes. Therefore, the role of SCFA, particularly butyrate and butyrate-producing bacteria such as Bifidobacterium spp., Bacteroides spp., F. prausnitzii and R. intestinalis are crucial for health in obesity and diabetes [36]. Taking into account this fact we can conclude that the decreased level of butyrate-producing bacteria indicates inflammation processes
which are associated with NCDs.
Thus, from the work presented here, it can be concluded that the gut microbiota alteration contributes to the development of NCDs such as obesity, T2D mellitus, atherosclerosis, and CVDs. Thus, such knowledge can be applied in early diagnosis of those diseases. Analyzing the experimental data obtained, and taking into account results of our previous studies, we can suggest that selected edible plants fruits extracts can be used as components of personalized nutrition for prevention and treatment of NCDs related to chronic inflammation. However, in vivo investigations are necessary to confirm the interactions between microbiota modulating and intestinal beneficial effects.
This work was supported by the Ministry of Education and Science of Ukraine, grant no. 0117U000379 the introduction of new approaches to the creation and use of modern pharmabiotics.
REFERENCES
1. WHO Organization Fact sheet: the top 10 causes of death. World Health Organization, Geneva, Switzerland. 2017.
2. West C. E., Renz H., Jenmalm M. C., KozyrskyjA. L, Allen K. J., Vuillermin P., Prescott S. L.; inFLAME Microbiome Interest Group. The gut microbiota and inflammatory noncommuni-cable diseases: associations and potentials for gut microbiota therapies. J. Allergy. Clin. Immunol. 2015, 135(1), 3-13. quiz 14. https:// doi.org/10.1016/j.jaci.2014.11.012.
3. Lazar V., Ditu L.M., Pircalabioru G.G., Picu A., Petcu L., Cucu N., Chifiriuc M.C. Gut microbio-ta, host organism, and diet trialogue in diabetes and obesity. Front Nutr. 2019 Mar 13, 6-21. https://doi.org/10.3389/fnut.2019.00021 .
4. Lloyd-Price J., Abu-Ali G., Huttenhower C. The healthy human microbiome. Genome Med. 2016 Apr 27, 8(1), 51. https://doi.org/10.1186/ s13073-016-0307-y.
5. Hotamisligil G.S. Inflammation and metabolic disorders. Nature. 2006 Dec 14, 444(7121), 860-867. https://doi.org/10.1038/nature05485 .
6. Hotamisligil G.S. Endoplasmic reticulum stress and the inflammatory basis of metabolic disease. Cell. 2010 Mar 19, 140(6), 900-917. https://doi.org/10.1016/j.cell.2010.02.034.
7. Forkosh E., Ilan Y. The heart-gut axis: new target for atherosclerosis and congestive heart failure therapy. Open Heart. 2019 Apr
23, 6(1):e000993. https://doi.org/10.1136/ openhrt-2018-000993
8. Cox A.J., West N.P., Cripps A.W. Obesity, inflammation, and the gut microbiota. Lancet Diabetes Endocrinol. 2015 Mar, 3(3), 207-15. https://doi.org/10.1016/S2213-8587(14)70134-2.
9. Piya M.K., Harte A.L., McTernan P.G. Metabolic endotoxaemia: is it more than just a gut feeling? Curr Opin Lipidol. 2013 Feb, 24(1), 78-85. https://doi.org/10.1097/ M0L.0b013e32835b4431.
10. Gérard P. Gut microbiota and obesity. Cell Mol. Life Sci. 2016 Jan;73(1), 147-62. https://doi. org/10.1007/s00018-015-2061-5.
11. Tazoe H., Otomo .Y., Kaji I., Tanaka R., Kara-ki S.I., Kuwahara A. Roles of short-chain fatty acids receptors, GPR41 and GPR43 on co-lonic functions. J. Physiol. Pharmacol. 2008 Aug 59, Suppl 2, 251-262.
12. Boulangé C. L, Neves A. L, Chilloux J., Nicholson J. K., Dumas M. E. Impact of the gut microbiota on inflammation, obesity, and metabolic disease. Genome Med. 2016 Apr 20, 8(1), 42. https://doi.org/10.1186/s13073-016-0303-2.
13. Remely M., Tesarl., Hippe B., GnauerS., Rust P., Haslberger A. G. Gut microbiota composition correlates with changes in body fat content due to weight loss. Benef Microbes. 2015,
6(4), 431-439. https://doi.org/10.3920/ BM2014.0104.
14. Long A. N, Dagogo-Jack S. Comorbidities of diabetes and hypertension: mechanisms and approach to target organ protection. J. Clin. Hypertens (Greenwich). 2011, 13(4), 244-251. https://doi.org/10.1111/j.1751-7176.2011.00434.x
15. Gui T., Shimokado A., Sun Y., Akasaka T, Muragaki Y. Diverse roles of macrophages in atherosclerosis: from inflammatory biology to biomarker discovery. Mediators Inflamm. 2012, Article ID 693083. https:// doi.org/10.1155/2012/693083 .
16. Gregory J. C., Buffa J. A., Org E., Wang Z., Levison B. S., Zhu W., Wagner M. A., Bennett B. J., Li L., DiDonato J. A., Lusis A. J., Hazen S. L. Transmission of atherosclerosis susceptibility with gut microbial transplantation. J Biol Chem. 2015 Feb 27, 290(9), 5647-5660. https://doi.org/10.1074/jbc. M114.618249 .
17. Jie Z., Xia H., Zhong S.L., Feng Q., Li S., Liang S., Zhong H., Liu Z., Gao Y., Zhao H., Zhang D., Su Z., Fang Z., Lan Z., Li J., Xiao L., Li J., Li R., Li X., Li F., Ren H., Huang Y., Peng Y., Li G., Wen B., Dong B., Chen J.Y., Geng Q.S., Zhang Z.W., Yang H., Wang J., Wang J., Zhang X., Madsen L., Brix S., Ning G., Xu X., Liu X., Hou Y., Jia H., He K., Kristiansen K. The gut microbiome in atherosclerotic cardiovascular disease. Nat Commun. 2017 Oct 10, 8(1), 845. https://doi.org/10.1038/ s41467-017-00900-1
18. Ercolini, D., Fogliano, V. Food design to feed the human gut microbiota. Journal of Agricultural and Food Chemistry. 2018, 66(15), 3754-3758. https://doi.org/10.1021/acs. jafc.8b00456.
19. Obesity and overweight WHO Organization Available at: https://www.who.int/news-room/fact-sheets/detail/obesity-and-over-weight (accessed. 6 October 2020)
20. Care D. Medical Care in Diabetes 2020. Diabetes Care. 2020, 43, S135.
21. Toth S., Fedacko J., Pekarova T., Hertelyova Z, Katz M., Mughees A., Kuzma J., Stefanic P., Kopolovets I., Pella, D. Elevated circulating PCSK9 concentrations predict subclinical atherosclerotic changes in low risk obese and non-obese patients. Cardiol Ther 6, 281-289 (2017). https://doi.org/10.1007/s40119-017-0092-8.
22. World Health Organization Cardiovascular Disease. Available at: https://www.who.int/ cardiovascular_diseases/about_cvd/en/ (accessed. 6 October 2020)
23. Bartosch S, Fite A, Macfarlane G. T., Mc-Murdo M. E. Characterization of bacterial
communities in feces from healthy elderly volunteers and hositalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbio-ta. Appl Environ Microbiol. 2004, V. 70, 3575-3581.
24. Ramirez-Farias C., Slezak K., Fuller Z., Duncan A., Holtrop G., Louis P. Effect of inulin on the human gut microbiota: stimulation of Bifidobacterium adolescentis and Faecalibac-terium prausnitzii. British Journal of Nutrition. 2008, 101(4), 541-550.
25. Gui Q., Li H., Wang A., Zhao X., Tan Z., Chen L, Xu K., Xiao, C. The association between gut butyrate-producing bacteria and non-small-cell lung cancer. Journal of Clinical Labora-toryAnalysis. 2020, e23318.
26. EverardA., BelzerC., Geurts L., Ouwerkerk J. P., Druart C., Bindels L. B., Guiot Y., Derrien M., Muccioli G. G., Delzenne N. M., Cani P. D., De Vos, W. M. Cross-talk between Akkermansia muciniphila and intestinal epithelium controls diet-induced obesity. Proceedings of the national academy of sciences. 2013, 110(22), 9066-9071.
27. Fijan S., Sulc D., Steyer A. Study of the in vitro antagonistic activity of various singlestrain and multi-strain probiotics against Escherichia coli. International journal of environmental research and public health. 2018, 15(7), 1539.
28. Vinnikova O. I., Morgul I. M. Practicum on microbiology: methodical recommendations. 2nd edition, amended. KhNU named after V. N. Karazin. 2009.
29. Pallah O. V., Meleshko T. V., Bati V. V., Boyko N. V. Extracts of edible plants stimulators for beneficial microorganisms. Biotech-nol. Acta. 2019, 12(3), 67-74 https://doi. org//10.15407/biotech12.03.067.
30. Al-Assal K., Martinez A. C., Torrinhas R. S., Cardinelli C., Waitzberg D. Gut microbio-ta and obesity. Clinical Nutrition Experimental. 2018. V.20, 60-64. https://doi. org/10.1016/j.yclnex.2018.03.001.
31. Petrov V. O., Boyko N. V. Early markers for diagnostics of obesity, diabetes, and metabolic syndrome. Ukraine Patent. 90788 U June, 10 2014.
32. Heidenreich PA, Trogdon J.G., Khavjou OA, Butler J., Dracup K., Ezekowitz M.D., Finkel-stein E.A., Hong Y., Johnston S.C., Khera A., Lloyd-Jones D.M., Nelson S.A., Nichol G., Oren-stein D., Wilson P.W., Woo Y.J. Forecasting the future of cardiovascular disease in the United States: a policy statement from the American Heart Association. Circulation. 2011 Mar 1, 123(8), 933-944. https://doi.org/10.1161/ CIR.0b013e31820a55f5
33. Cho C.E., TaesuwanS.,MalyshevaO. V.,Bender E., Tulchinsky N. F., Yan J., Sutter J. L, Caudill M. A. Trimethylamine-N-oxide (TMAO) response to animal source foods varies among healthy young men and is influenced by their gut microbiota composition: A randomized controlled trial. Mol. Nutr. Food Res. 2017 Jan, 61(1). https://doi. org/10.1002/mnfr.201600324
34. Biscetti F., Nardella E., CecchiniA.L., Land-olfi R., Flex A. The role of the microbiota in the diabetic peripheral artery disease. Mediators Inflamm. 2019, May 8, 4128682. https://doi.org/10.1155/2019/4128682
35. Lazar V., Ditu L.M., Pircalabioru G. G., Picu A., Petcu L., Cucu N., Chifiriuc M. C. Gut mi-crobiota, host organism, and diet trialogue in diabetes and obesity. Front Nutr. 2019 Mar 13, No 6, 21. https://doi.org/10.3389/ fnut.2019.00021
36. Patterson E., Ryan P. M., Cryan J. F., Di-nan T. G., Ross R. P., Fitzgerald G. F., Stan-ton C. Gut microbiota, obesity and diabetes. Postgrad Med J. 2016 May, 92(1087), 286-300. https://doi.org/10.1136/ postgradmedj- 2015-133285
ВПЛИВ ЕКСТРАКТ1В 1СТ1ВНИХ ПЛОД1В НА КИШКОВУ М1КРОБ1ОТУ, ВИД1ЛЕНУ З ПАЩеНТ1В З НЕКОМУН1КАТИВНИМИ ЗАХВОРЮВАННЯМИ, ПОВ'ЯЗАНИМИ З ХРОН1ЧНИМ ЗАПАЛЕННЯМ
Т. В. Мелешко 1 2, О. В. Паллаг 1 2, Р. О. Рукавчук 2, Л. С. Юсько 1 2, Н. В. Бойко 1 2
1Ужгородський нащональний ушверситет, кафедра клшшо-лабораторно! дiагностики та фармакологи, стоматолопчний факультет, Укра!на
2Ужгородський нащональний ушверситет,
науково-дослщний i навчальний центр молекулярно! мшробмлогй та iмунологil слизових оболонок, Укра!на
E-mail: meleshkotv@ukr.net
Метою роботи було досл^ити кишкову мшроб^ту у пащенмв з некомунiкативними захворюваннями, пов'язаними з хронiчним запаленням, зокрема ожиршням, цукровим дiабетом 2-го типу, атеросклерозом та сер-цево-судинними захворюваннями, а також з'ясувати потенцшну здатшсть екстрактiв плодiв !сивних рослин пригшчувати рiст ок-ремих умовно-патогенних мiкроорганiзмiв.
В обмеженому клiнiчному досл^женш аналiз мiкробiоти кишечника проводили ру-тинним методом, а також за допомогою qPCR. Вивчено антибактерiальнi властивосм екстрак-тiв плодiв !смвних рослин стосовно вЩбраних умовно-патогенних мiкроорганiзмiв.
Склад кишково! мiкробiоти пацieнтiв з ожиршням характеризувався збiльшенням кiлькостi Enterococcus spp. та Lactobacillus spp. поряд зi зменшенням к^ькост1 Escherichia coli. Зниження рiвня E. coli та
ВЛИЯНИЕ ЭКСТРАКТОВ СЪЕДОБНЫХ ПЛОДОВ НА МИКРОБИОТУ КИШЕЧНИКА, ВЫДЕЛЕННОЙ
ИЗ ПАЦИЕНТОВ С НЕКОММУНИКАТИВНЫМИ ЗАБОЛЕВАНИЯМИ, СВЯЗАННЫМИ С ХРОНИЧЕСКИМ ВОСПАЛЕНИЕМ
Т. В. Мелешко 1 2, О. В. Паллаг 1 2, Р. А. Рукавчук 2, Л. С. Юсько 1 2, Н. В. Бойко 1 2
1Ужгородский национальный университет, кафедра клинико-лабораторной диагностики и фармакологии, стоматологический факультет, Украина 2Ужгородский национальный университет, научно-исследовательский и учебный центр молекулярной микробиологии и иммунологии слизистых оболочек, Украина
E-mail: meleshkotv@ukr.net
Целью работы было исследовать микробио-ту кишечника у пациентов с некоммуникативными заболеваниями, связанными с хроническим воспалением, в частности с ожирением, сахарным диабетом 2-го типа, атеросклерозом и сердечно-сосудистыми заболеваниями, а также выяснить потенциальную способность экстрактов плодов съедобных растений подавлять рост отдельных условно-патогенных микроорганизмов.
В ограниченном клиническом исследовании анализ микробиоты кишечника проводили рутинным методом, а также с помощью qPCR. Изучены антибактериальные свойства плодов съедобных растений по отношению к отобранным условно-патогенным микроорганизмам.
Состав микробиоты кишечника пациентов с ожирением характеризовался увеличением количества Enterococcus spp. и Lactobacillus spp.
лактобактерш спостер^али у пащенмв з цук-ровим дiабетом 2-го типу. За атеросклерозу вщзначали зб^ьшення стрептококiв, ентеро-кокiв та ентеробактерш, тодi як у пацieнтiв Í3 серцево-судинними захворюваннями на-явним було додаткове шдвищення кiлькостi стафiлококiв та кандид поряд 3Í зниженням E. coli. Зменшення кiлькостi Bifidobacterium spp., Bacteroides spp., Roseburia intestinalis та Akkermansia muciniphila спостер^али у пащенив усiх груп. Рiст Klebsiella spp. при-гнiчували екстракти червоно! смородини (Ribes rubrum) i сливи (Prunus domestica); Enterobacter spp. — екстракт черешн (Prunus avium); Proteus spp. — екстракти чорнищ (Vaccinium myrtillus) та кизилу (Cornus mas); Staphylococcus spp. — екстракти чорно! смородини (Ribes nigrum), черешш (Prunus avium), сливи (Prunus domestica), йошти (Ribes nigrum х Ribes divaricatum x Ribes uva-crispa), аличi (Prunus cerasifera) та кизилу (Cornus mas).
Отримаш дат можуть бути використаш для ранньо! дiагностики некомушкативних захворювань та для !х проф^актики за допо-могою персонiфiкованого харчування.
Ключовi слова: ожиршня, цукровий дiабет 2-го типу, атеросклероз, серцево-судинш захворювання, кишкова мiкробiота, плоди !смвних рослин.
наряду с уменьшением количества Escherichia coli. Снижение уровня E. coli и лактобакте-рий наблюдали у пациентов с сахарным диабетом 2-го типа. При атеросклерозе отмечали увеличение количества стрептококков, энтерококков и энтеробактерий, в то время как у пациентов с сердечно-сосудистыми заболеваниями характерным было дополнительное увеличение количества стафилококков и кандид наряду со снижением E. coli. Уменьшение количества Bifidobacterium spp., Bacteroides spp., Roseburia intestinalis и Akkermansia muciniphila наблюдали у пациентов всех групп. Рост Klebsiella spp. ингибировался экстрактами красной смородины (Ribes rubrum) и сливы (Prunus domestica); Enterobacter spp. — экстрактом черешни (Prunus avium); Proteus spp. — экстрактами черники (Vaccinium myrtillus) и кизила (Cornus mas); Staphylococcus spp. — экстрактами черной смородины (Ribes nigrum), черешни (Prunus avium), сливы (Prunus domestica), йошты (Ribes nigrum x Ribes divaricatum x Ribes uva-crispa), алычи (Prunus cerasifera) и кизила (Cornus mas).
Полученные данные могут быть использованы для ранней диагностики некоммуникативных заболеваний и для их профилактики с помощью персонифицированного питания.
Ключевые слова: ожирение, сахарный диабет 2-го типа, атеросклероз, сердечно-сосудистые заболевания, микробиота кишечника, плоды съедобных растений.
