CC BY
34
ЕКСПЕРИМЕНТАЛЬНІ СТАТТІ
УДК577.112:616
DOMINANT-NEGATIVE CONSTRUCTS OF HUMAN 6-PHOSPHOFRUCTO-2-KINASE/ FRUCTOSE-2,6-BISPHOSPHATASE-3 AND -4: EFFECT ON THE EXPRESSION OF ENDOGENOUS 6-PHOSPHOFRUCTO-2-KINASE/FRUCTOSE-2,6-BISPHOSPHATASE mRNA
D. O. Minchenko1 1Palladin Institute of Biochemistry of National Academy of Science of Ukraine, Kyiv
A. Y. Bobarykina1
O. O. Ratushna1 2Research Center for Innovative Oncology of National Cancer Center Hospital East,
R. Y. Marunych1, Kashiwa, Japan
K. Tsuchihara2
M. Moenner3 3INSERM U920 Molecular Mechanisms of Angiogenesis Laboratory, University
J. Caro4 Bordeaux 1, Talence, France
H. Esumi2
O. H. Minchenko1,2, * 4Department of Medicine, Jefferson Medical College of Thomas Jefferson
University, Philadelphia, PA, USA * Foreign Research Fellow of the Foundation for Promotion of Cancer Research, Tokyo
E-mail: [email protected]
Expression of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFKFB), a key regulatory enzyme of glycolysis, is significantly increased in different malignant tumors provides a potential mechanism of enhanced glycolysis and cancer cell proliferation. We created dominant-negative constructs of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 and -4 (dnPFKFB-3 and dnPFKFB-4) cDNA for suppression of strongly enhanced expression endogenous PFKFB-3 and PFKFB-4. We introduce point mutation in ATP-binding domain of 6-phosphofructo-2-kinase part of PFKFB-3 as well as PFKFB-4 cDNA for suppression of 6-phosphofructo-2-kinase activity in the products of dnPFKFB-3 and dnPFKFB-4 expression. Cancer cells were stable transfected with these dominant-negative constructs for suppression of endogenous PFKFB-3 and PFKFB-4 expression and cell proliferation. We have shown that PFKFB-3 expression in pancreatic cancer cell line Pancl, stable transfected by dnPFKFB-3, was significantly reduced in normal as well as in hypoxic conditions. Pancreatic cancer cells proliferation, stable transfected by dnPFKFB-3 or dnPFKFB-4, was also reduced. Results of this investigation demonstrate possibility to apply the dominant-negative constructs of PFKFB-3 and PFKFB-4 for suppression of glycolysis and tumor cells proliferation via reduction of endogenous PFKFB expression.
Key words: PFKFB-4 mRNA, PFKFB-3 mRNA, dominant-negative constructs, cancer cells.
The homodimeric bifunctional enzyme 6-phosphofructo-2-kinase/fructose-2,6-bisphos-phatase [6-phosphofructo-2-kinase (EC 2.7.1.105); fructose-2,6-bisphosphatase (EC 3.1.3.46)] has both kinase and bisphosphatase activities and catalyses the synthesis and degradation of fructose-2,6-bisphosphate, a signal molecule that control glycolysis [1-4]. Moreover, 6-phosphofructo-2-kinase/fruc-tose-2,6-bisphosphatase (PFKFB) is a key
enzyme in the regulation of glycolysis as well as gluconeogenesis in normal and different pathological conditions, in particular in malignant tumors [4-10]. X-ray crystallography shown that 6-phosphofructo-2-kinase domain has the same fold as adenylate kinase [11]. The fructose-2,6-bisphosphatase domain of the enzyme subunit bears sequence, mechanistic and structural similarity to the histidine phosphatase family of enzymes, including
the acid phosphatases and phosphoglycerate mutases [5, 11]. Therefore, fructose-2,6-bis-phosphate plays a unique role in the control of glucose homeostasis by allowing the liver to switch from glycolysis to gluconeogenesis [4,
5, 7]. There are four 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase isoenzymes (PFKFB-1, PFKFB-2, PFKFB-3 and PFKFB-4) in mammals, each coded by a different gene (pfkfb 1, pfkfb2, pfkfb3 and pfkfb4). Moreover, these genes express several isoforms of each isoenzyme with different kinetic and regulatory properties [4, 5, 12, 13]. It was shown that different tissues as well as cancer cell lines express more than one isoform [13-16]. This multiple expression of PFKFB isozymes with different properties suggests that each isoenzyme can play a specific role in the regulation of glycolysis in some physiologic and different pathophysiological conditions.
Overexpression of PFKFB isozymes as well as enhanced glycolysis is observed in most malignant tumors and in different cancer cell lines and significantly increases in hypoxic conditions [13-19]. The metabolism within a solid tumor is significantly different from that of the surrounding normal tissue. Tumors growing under conditions of normal oxygen tension show elevated glycolytic rates, produce high levels of lactate and pyruvate (the Warburg effect) that correlate with the increased expression of glycolytic enzymes and glucose transporters via HIF-1 dependent mechanism [1-4, 20-25]. In tumor over 50% of the cellular energy is produced by glycolysis with the remainder being generated at the mitochondria. The reliance of tumor cells on glycolysis for energy production causes them to consume more glucose because of the low efficiency of glycolysis in generating ATP [23]. Thus, glycolysis is essential for tumor survival and spread. Moreover, 6-phospho-fructo-2-kinase/fructose-2,6-bisphosphatase has a key role for the neoplastic transformation and provide rationale for the development of agents that selectively inhibit the PFKFB-3 enzyme as antineoplastic agents. Moreover, hypoxia is a common feature of many cancers and has been linked to malignant transformation, metastasis, and treatment resistance [23-27]. Most of tumors are subjected to hypoxic conditions due to the abnormal vasculature that supply them with oxygen and nutrients. Transcription complex HIF-1 is overexpressed in a variety of tumors and its expression appears to correlate with poor prognosis and responses to chemo- or radio-
therapy. The most PFKFB isozymes are contribute to de novo nucleic acid synthesis in tumor cells, are uniformly increased in the malignant tissues and provide a potential mechanism to explain the apparent coupling of enhanced glycolysis and cell proliferation [6, 7, 17-19, 28, 29].
Previously, we have shown that the pfkfb4 gene is overexpressed in several cancer cell lines and is highly induced by hypoxia via HIF-1 dependent mechanism [14].
The pfkfb3 gene encoded 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase isozyme ubiquitously expressed in different organs and tumor cells [8, 13-15, 17-19]. Several alternative splice variants of PFKFB-
3 mRNA with variable C-terminus were identified in human brain and different rat and mouse tissues [30-35]. There were isolated eight isoforms of PFKFB-3 mRNA from brain and some other tissues. The cDNA sequences encoding the 5'-untranslated region, the amino-terminal domain, and the catalytic core domain were identical among all these isoforms. However, heterogeneity of the carboxyl-ter-minus was found by sequence analysis.
Many genes whose expression is regulated by hypoxia are overexpressed in malignant tissues and cell lines and contain HIF-1 binding site (hypoxia-responsible element, HRE) [14,
16, 36-38]. HRE was recently identified in pfkfb3 and pfkfb4 genes [14, 39-41]. Transcription factor HIF is central in coordinating many of the transcriptional adaptations to hypoxia and a necessary mediator of the hypoxic effect as well as Pasteur effect in mammalian cells and Warburg effect in tumors [29, 37, 42, 43]. Thus, targeting PFKFB enzymes, either directly or through inhibition of HIF-1, appears as a promising approach for the treatment of certain tumors.
Despite importance of PFKFB-3 and PFKFB-4 in the regulation of glycolysis, the dominant-negative constructs of 6-phospho-fructo-2-kinase/fructose-2,6-bisphosphatase-
3 and -4 cDNA were not been created and used yet for suppression of glycolysis. In this work we have created dnPFKFB-3 and dnPFKFB-4 constructs and studied the expression of endogenous PFKFB-3 and PFKFB-4 mRNA in pancreatic cancer cells stable transfected with these constructs.
Materials and methods
Cell lines. Human pancreatic cancer cell lines Pank1 and PSN-1 were obtained from the American Type Culture Collection (ATCC,
USA) and grown according to the supplier’s protocols. The cells were incubated at 37 0C before harvesting under normoxic (21% oxygen and 5% carbon dioxide) or hypoxic conditions, which were modulated by dimethyloxa-lylglycine (1 mM during 6 hours) [15].
RNA isolation. Total RNA was extracted using Trizol reagent according to the manufacturer’s protocols (Invitrogen, USA). RNA pellet was washed with 75% ethanol, dissolved in nuclease-free water and used for reverse transcription.
Synthesis and cloning of PFKFB-3 and PFKFB-4 cDNA. The human PFKFB-3 and PFKFB-4 cDNA was synthesized by RT-PCR using total RNA from human pancreatic cancer cell lines Pank1 and oligo(dT). For first-strand cDNA synthesis was used Sensiscript RT Kit (QIAGEN, Germany). Human PFKFB-
3 PCR amplification was performed with the following oligonucleotides: 5'-GATGCCGTTG-GAACTGACGC-3' (forward primer) and 3'-CTGAGGCAGACGTGTCGGTT-5' (reverse primer) using HotStarTaq Master Mix Kit (QIAGEN). These oligonucleotides correspond to nucleotide sequences 329-348 and 1889-1908 of human PFKFB-3 mRNA (GenBank accession number NM_004566). The amplification of human PFKFB-4 was performed with the following oligonucleotides: 5'-GATGGCGTCC-CCACGGGAATTG -3' (forward primer) and 3'-GCTCACCAGTGACCATGTTC-5' (reverse primer) using HotStarTaq Master Mix Kit (QIAGEN). These oligonucleotides correspond to nucleotide sequences 17-38 and 1416-11435 of human PFKFB-3 mRNA (GenBank accession number NM_004566). The PFKFB-3 and PFKFB-4 cDNA were cloned into pCRII-TOPO
(Invitrogen, USA) vector as described previously [14] and used for creation of dominant-negative constructs (dnPFKFB-3 and dnPFKFB-4). These constructs were verified by sequencing the insert in the plasmid. Sequence analysis was performed using ABI Prism (Model 3100, version 3.7). The dnPFKFB-3 and dnPFKFB-4 cDNA were recloned into pcDNA3.1 (Invitrogen, USA) and used for transfection assays.
The expression of PFKFB-3 mRNA in Panc1 cells was examined by ribonuclease protection assays as described previously [15, 46], but probes corresponds to 3'-region (3193-3540; GenBank accession number NM_004566). The 18S rRNA antisense probe was used to ensure equal loading of the sample of total RNA. The expression of PFKFB-3 and PFKFB-4 mRNA in Pst-1 cells was examined by real time RCR analysis assays. Quantitative PCR was performed on «Stratagene Mx 3000P cycler», using SYBRGreen Mix as described previously [47]. Reaction was performed in triplicate. Analysis of quantitative PCR was performed using special computer program «Differential expression calculator» and statistic analysis — in Excel program.
Results and Discussion
We synthesized the human PFKFB-3 and PFKFB-4 cDNA using total RNA from human pancreatic cancer cell line Panc1. Both cDNA were amplified and cloned into pCRII-TOPO vector. For inactivation of 6-phosphofructo-2-kinase we changed four nucleotide residues in domain «A» using special primers. As shown in Fig. 1 and 2, this nucleotide replacement in
[c tgcjag- P s 11
430 440 450 460 470 480
tgaccaactcccccaccgtcatcgtcatggtgggcctccccgcccggjggca|agacctaca |PFKFB-3|
TNSPTVIVMVC L P * Б |G Kj T Y I
V'-domain |b el
Fig. 1. Fragment of 6-phosphofructo-2-kinase part of human PFKFB-3 cDNA (GenBank accession number NM_004566), containing domain «A» (underlined). Four nucleotide residues (GGCA) into domain «A» were replaced by CTGC. These changes create new restriction site (PstI) and replace two amino acids residues: G and K
Fig. 2. Fragment of 6-phosphofructo-2-kinase part of human PFKFB-4 cDNA (GenBank accession number NM_004567), containing domain «A» (underlined). Four nucleotide residues (GGCA) into domain «A» were replaced by CTGC. These changes create new restriction site (PstI) and replace two amino acids residues: G and K
PFKFB-3 and PFKFB-4 creates new restriction site (PstI) and changes two amino acids residues: G to L and K to Q. These changes should suppress the 6-phosphofructo-2-kinase activity because K residue is crucial for keeping kinase activity. These modified PFKFB-3 and PFKFB-4 cDNA represent dominant-negative variants in respect to 6-phosphofructo-2-kinase activity.
We recloned modified human PFKFB-3 and PFKFB-4 cDNA into eukaryotic expression vector pcDNA3.1(+) using EcoRI and Xbal restriction nuclease sites. Structure of dominant-negative construct of PFKFB-3 (dnPFKFB-3) shown on Fig. 3. Same structure has dnPFKFB-4. Both dominant-negative constructs were used for transfection experiments. We received clone of Pancl cells stable transfected by dnPFKFB-3.
Fig. 3. Dominant-negative plasmid construction of human PFKFB-3 cDNA, which contains PFKFB-3 cDNA with modified 6-phosphofructo-2-kinase domain «A» into pcDNA3.1(+) vector
The effect of PFKFB-3 dominant-negative construct on the expression of endogenous PFKFB-3 mRNA is shown in Fig. 4. For this analysis was used 3'-terminus of PFKFB-3 mRNA because dnPFKFB-3 construct does not contains this region of PFKFB-3. Pancreatic cancer cells, stable transfected by dnPFKFB-
3, have significantly lower expression of endogenous PFKFB-3 mRNA as in normoxic and hypoxic conditions, which were modulated by dimethyloxalylglycine (Fig. 4 and 5).
Fig. 4. Endogenous PFKFB-3 mRNA expression in pancreatic carcinoma cell line Pancl stable transfected by pcDNA3.1(+) vector (Pancl cells) and stable transfected by dnPFKFB-3 (Pancl + dnPFKFB-3) in normoxic (N) and hypoxic conditions (I), which were modulated by dimethyloxalylglycine (1 mM during 6 hours). The 18S rRNA antisense probe was used to ensure equal loading of the sample of total RNA
Fig. 5. Quantification of endogenous PFKFB-3 mRNA expression in pancreatic carcinoma cell line Pancl stable transfected by pcDNA3.1(+) vector or dnPFKFB-3 in normoxic (N) and hypoxic (I) conditions; n = 5
PFKFB-3 and PFKFB-4 mRNA expression was also measured in other pancreatic carcinoma cell line PSN-1 stable transfected by pcDNA3.1(+) vector, dnPFKFB-3 or dnPFKFB-4. Results of these experiments are shown on Fig. 6. PSN-1 cells transfected with dnPFKFB-3 shown lower level of endogenous PFKFB-3 mRNA expression. Moreover, the expression of PFKFB-4 mRNA in these cells also decreased. It is possible that there is some interaction between different PFKFB genes in molecular mechanisms of PFKFB suppression by dominant-negative constructs. Same effect has dnPFKFB-4 on the of endogenous PFKFB-
4 and PFKFB-3 mRNA.
mRNA expression (% from control)
Fig. 6. Endogenous PFKFB-3 and PFKFB-4 mRNA expression in pancreatic carcinoma cell line PSN-1 stable transfected with pcDNA3.1(+) vector, dnPFKFB-3 and dnPFKFB-4
LITERATURE
1. Okar D. A., Lange A. J. Fructose-2,6-bisphos-phate and control of carbohydrate metabolism in eukaryotes // Biofactors. — 1999. — V. 10, N1. — P. 1-14.
2. Kawaguchi T., Veech R. L., Uyeda K. Regulation of energy metabolism in macrophages during hypoxia. Roles of fructose 2,6-bisphosphate and ribose 1,5-bispho-sphate // J. Biol. Chem. — 2001. — V. 276, N30. — P. 28554 — 28561.
3. Rousseau G. G., Hue L. Mammalian 6-phos-phofructo-2-kinase/fructose-2,6-bisphos-phatase: a bifunctional enzyme that control glycolysis // Prog. Nucleic Acid Res. Mol. Biol. — 1993. — V. 45. — P. 99 — 127.
4. Okar D. A., Manzano A, Navarro-Sabate A. et al. PFK-2/FBPase-2: maker and breaker of the essential biofactor fructose-2,6-bisphos-phate // Trends Biochem. Sci. — 2001. — V. 26, N1. — P. 30 — 35.
5. Rider M. H., Bertrand L., Vertommen D. et al. 6-phosphofructo-2-kinase/fructose-2,6-bis-phosphatase: head-head with a bifunctional enzyme that controls glycolysis // Biochem. J. — 2004. — V. 381, Pt. 3. — P. 561-579.
6. Atsumi T., Chesney J., Metz C. et al. High expression of inducible 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 (iPFK-2; PFKFB3) in human cancers // Cancer Res. — 2002. — V. 62, N20. — P. 5881-5887.
7. Atsumi T., Nishio T., Niwa H. et al. Expression of inducible 6-phosphofructo-2-kinase/fruc-tose-2,6-bisphosphatase/PFKFB3 isoforms in adipocytes and their potential role in glycolytic regulation // Diabetes. — 2005. — V. 54, N12. — P. 3349-3357.
8. Chesney J. 6-phosphofructo-2-kinase/fruc-tose-2,6-bisphosphatase and tumor cell glycolysis // Curr. Opin. Clin. Nutr. Metab. Care. — 2006. — V. 9, N5. — P. 535-539.
9. Bando H., Atsumi T., Nishio T. et al. Phosphorylation of the 6-phosphofructo-2-kinase/fructose 2,6-bisphosphatase/
PFKFB3 family of glycolytic regulators in human cancer // Clin. Cancer Res. 2005. — V. 11, N16 — P. 5784-5792.
10. Calvo M. N., Bartrons R., Castano E. et al. PFKFB3 gene silencing decreases glycolysis, induces cell-cycle delay and inhibits anchorage-independent growth in HeLa cells // FEBS Lett. — 2006. — V. 580, N13. — P. 3308-3314.
11. Bertrand L., Vertommen D., Depiereux E. et al. Modelling the 2-kinase domain of 6-phos-phofructo-2-kinase/fructose-2,6-bisphos-phatase on adenylate kinase // Biochem. J. — 1997. — V. 321, Pt. 3. — P. 615-621.
12. Sakakibara R., Okudaira T., Fujiwara K. et al. Tissue distribution of placenta-type 6-phos-phofructo- 2-kinase/fructose-2,6-bisphos-phatase // Biochem. Biophys. Res. Commun. —
1999. — V. 257, N1. — P. 177-181.
13. Minchenko O., Opentanova I., Caro J. Hypoxic regulation of the 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 gene family (PFKFB-1-4) expression in vivo // FEBS Lett. — 2003. — V. 554, N3. — P. 264-270.
14. Minchenko O. H., Opentanova I. L., Minchen-ko D. O. et al. Hypoxia induces transcription of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 4 gene via hypoxia-inducible factor-1alpha activation // Ibid. — 2004. — V. 576, N1. — P. 14-20.
15. Minchenko A. G., Leshchinsky I., Opentanova I. et al. Hypoxia-inducible factor-1-mediated expression of the 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 (PFKFB3) gene // J. Biol. Chem. — 2002. — V. 277, N8. — P. 6183-6187.
16. Mykhalchenko V. G., Kovtun O. O., Bobaryki-na A. Y., Minchenko O. H. Molecular mechanisms of the regulation of the 6-phospho-fructo-2-kinase/fructose-2,6-bisphosphatase genes expression in hypoxia // Bulletin Taras Shevchenko Kyiv National University. — 2006. — Issue 11. — P. 18-24.
17. Minchenko O. H., Ogura T., Opentanova I. L. et al. 6-Phosphofructo-2-kinase/fructose-
2,6-bisphosphatase gene family overexpression in the lung tumor // YKp. QioxiM. mypH. — 2005. — T. 77, №6. — C. 46-50.
18. Bobarykina A Y., Minchenko D. O., Openta-nova I. L. et al. Hypoxic regulation of PFKFB-3 and PFKFB-4 gene expression in gastric and pancreatic cancer cell lines and expression of PFKFB genes in gastric cancers // Acta Biochim. Pol. — 2006. — V. 53, N4. — P. 789-799.
19. Minchenko O. H., Ochiai A., Opentanova I. L. et al. Overexpression of 6-phosphofructo-2-
kinase/fructose-2,6-bisphosphatase-4 in the human breast and colon malignant tumors // Biochimie. — 2005. — V. 87, N11. — P.1005-1010.
20. Warburg O. On respiratory impairment in cancer cells // Science. — 1956. — V. 123, N3191. — P. 309-314.
21. Hopfl G., Ogunshola O., Gassmann M. HIFs and tumors — causes and consequences // Am. J. Physiol. — 2004. — V. 286, N4. — P. R608-R623.
22. Chesney J., Mitchell R., Benigni F. et al. An inducible gene product for 6-phosphofructo-2-kinase with an AU-rich instability element: Role in tumor cell glycolysis and the Warburg effect // Proc. Natl. Acad. Sci. USA. — 1999. — V. 96, N6. — P. 3047-3052.
23. Denko N. C. Hypoxia, HIF1 and glucose metabolism in the solid tumor // Nat. Rev. Cancer. — 2008. — V. 8. — P. 705-713.
24. Hockel M., Vaupel P. Tumor hypoxia: definitions and current clinical, biologic, and molecular aspects // J. Natl. Cancer Inst. — 2001. — V. 93, N4. — P. 266-276.
25. Lu H., Forbes R. A., Verma A. Hypoxia-inducible factor 1 activation by aerobic glycolysis implicates the Warburg effect in carcinogenesis // J. Biol. Chem. — 2002. — V. 277, N26. — P. 23111-23115.
26. Bartrons R., Caro J. Hypoxia, glucose metabolism and the Warburg’s effect // J. Bio-energ. Biomembr. — 2007. — V. 39, N3. — P. 223-229.
27. Airley R. E., Mobasheri A. Hypoxic regulation of glucose transport, anaerobic metabolism and angiogenesis in cancer: novel pathways and targets for anticancer therapeutics // Chemotherapy. — 2007. — V. 53, N4. — P. 233-256.
28. Бобарикіна А. Ю., Мінченко Д. О., Опента-нова І. Л. та ін. Експресія мРНК HIF-1a, HIF-2a та VHL у різних лініях клітин при гіпоксії // Укр. біохім. журн. — 2006. — Т. 78, №2. — С. 49-59.
29. Hirata T., Watanabe M., Miura S. et al. Inhibition of tumor cell growth by a specific 6-phosphofructo-2-kinase inhibitor, N-bro-moacetylethanolamine phosphate, and its analogues // Biosci. Biotechnol. Biochem. — 2000. — V. 64, N10. — P. 2047-2052.
30. Kessler R., Eschrich K. Splice isoforms of ubiquitous 6-phosphofructo-2-kinase/fruc-tose-2,6-bisphosphatase in human brain // Mol. Brain Res. — 2001. — V. 87, N2. — P. 190-195.
31. Watanabe F., Sakai A., Furuya E. Novel isoforms of rat brain fructose 2-phospho 2-kinase/fructose 2,6-bisphosphatase are generated by tissue-specific alternative splicing // J. Neurochem. — 1997. — V. 69, N1. — P. 1-9.
32. Watanabe F., Furuya E. Tissue-specific alternative splicing of rat brain fructose 6-
phosphate 2-kinase/fructose 2,6-bisphos-phatase // FEBS Lett. — 1999. — V. 458, N1. — P. 304-308.
33. Mykhalchenko V. G., Minchenko D. O., Tsuchihara K. et al. Expression of mouse 6-phosphofructo-2-kinase/fructose-2,6-bis-phosphatase-3 mRNA alternative splice variants in hypoxia // Укр. біохім. журн. — 2008. — Т. 80, №1. — С. 19-25.
34. Minchenko D. O., Tsuchihara K., Komisa-renko S. V. et al. Unique alternative splice variants of mouse PFKFB-3 mRNA: tissue specific expression // Scientific Bulletin National O.O. Bohomoletz Medical University. — 2008. — №1. — P. 72-78.
35. Minchenko O. H., Opentanova I. L., Ochiai A. et al. Splice isoform of 6-phosphofructo-2-kinase/ fructose-2,6-bisphosphatase-4: expression and hypoxic regulation. Mol. & Cell. Biochem. — 2005. — V. 280, N1-2. — P. 227-234.
36. Wykoff C. C., Pugh C. W., Maxwell P. H. et al. The HIF pathway: implications for patterns of gene expression in cancer // Novartis Found Symp. — 2001. — V. 240. — P. 212-225.
37. Wenger R. H. Cellular adaptation to hypoxia: O2-sensing protein hydroxylases, hypoxia-inducible transcription factors, and O2-regulated gene expression // FASEB J. — 2002. — V. 16, N10. — P. 1151-1162.
38. Minchenko A. G., Caro J.: Regulation of endothelin-1 gene expression in human microvascular endothelial cells by hypoxia and cobalt: role of hypoxia responsible element // Mol. & Cell. Biochem. — 2000. — V. 208.— P. 53-62.
39. Minchenko O. H., Opentanova I. L., Ogura T. et al. Expression and hypoxia-responsiveness of the 6-phosphofructo-2-kinase/fructose-
2.6-bisphosphatase 4 in the mammary gland malignant cell lines // Acta Biochim. Pol. — 2005. — V. 52, N4. — P. 881-888.
40. Fukasawa M., Tsuchiya T., Takayama E. et al. Identification and characterization of the hypoxia-responsive element of the human placental 6-phosphofructo-2-kinase/fructose-
2.6-bisphosphatase gene // J. Biochem. — 2004. — V. 136, N3. — P. 273-277.
41. Obach M., Navarro-Sabate A., Caro J. et al. 6-Phosphofructo-2-kinase (pfkfb3) gene promoter contains hypoxia-inducible factor-1 binding sites necessary for transactivation in response to hypoxia // J. Biol. Chem. — 2004. — V. 279, N51. — P. 53562-53570.
42. Walenta S., Salameh A., Lyng H. et al. Correlation of high lactate levels in head and neck tumors with incidence of metastasis // Am. J. Pathol. — 1997. — V. 150, N3. — P. 409-415.
43. Chen J., Zhao S., Nakada K. et al. Dominant-negative hypoxia-inducible factor-1 alpha
reduces tumorigenicity of pancreatic cancer cells through the suppression of glucose metabolism // Am. J. Pathol. — 2003. — V. 162, N4. — P. 1283-1291.
44. Ryan H. E., Poloni M., McNulty W. et al. Hypoxia-inducible factor-1 is a positive factor in solid tumor growth // Cancer Res. —
2000. — V. 60, N15. — P. 4010-4015.
45. Minchenko O. H., Ogura T., Opentanova I. L. et al. 6-Phosphofructo-2-kinase/fructose-
2,6-bisphosphatase gene family overexpression in the lung tumor // Укр. біохім. журн. — 2005. — Т. 77, №6. — С. 46-50.
ДОМІНАНТНЕГАТИВНІ КОНСТРУКЦІЇ 6-ФОСФОФРУКТО-2-КІНАЗИ/ФРУКТОЗО-2,6-БІСФОСФАТАЗИ-З ТА -4 ЛЮДИНИ: ВПЛИВ НА ЕКСПРЕСІЮ ЕНДОГЕННИХ мРНК 6-ФОСФОФРУКТО-2-КІНАЗИ/ ФРУКТОЗО-2,6-БІСФОСФАТАЗ
Д. О. Мінченко1 А. Ю. Бобарикіна1 О. О. Ратушна1 Р. Ю. Марунич1 K. Tсучігарa2 М. Моне3 Х. Каро4 Г. Есумі2 О. Г. Мінченко 1,2
1Інститут біохімії ім. О.В. Палладіна НАН України, Київ
2Науково-дослідний центр інноваційної онкології Східного госпіталю Національного онкологічного центру Японії, Kaшівa, Японія
3INSERM U920 Лабораторія молекулярних механізмів ангіогенезу Університету Бордо 1, Таленс, Франція
4Відділ медицини Джеферсон медичного коледжу Томас Джеферсон Університету, Філадельфія, США
E-mail: [email protected]
Експресія 6-фосфофрукто-2-кінази/фрук-тозо-2,6-бісфосфатази (PFKFB), ключового регуляторного ензиму гліколізу, різко зростає в різних злоякісних пухлинах, що розкриває можливий механізм посиленого гліколізу в ракових клітинах та їх проліферації. Ми створили домінантнегативні конструкції кДНК 6-фосфофрукто-2-кінази/фруктозо-2,6-бісфосфатази-3 та -4 (dnPFKFB-3 та dnPFKFB-4) для пригнічення посиленої експресії ендогенних PFKFB-3 та PFKFB-4. Для цього вводили точкові мутації в АТР-зв’язувальний домен
46. Minchenko O. H., Opentanova I. L., Ochiai A. et al. Splice isoform of 6-phosphofructo-2-kinase/ fructose-2,6-bisphosphatase-4: expression and hypoxic regulation // Mol. & Cell. Biochem. — 2005. — V. 280. — N1-2. — P. 227-234.
47. Mykhalchenko V. G., Tsuchihara K., Minchen-ko D. O. et al. 6-Phosphofructo-2-kinase/ fructose-2,6-bisphosphatase mRNA expression in streptozotocin-diabetic rats / / Biopolymers & Cell. — 2008. — V. 24, N3. — P. 260-266.
6-фосфофрукто-2-кінази як PFKFB-3, так і PFKFB-4 кДНК для пригнічення 6-фосфо-фрукто-2-кіназної активності у продуктах експресії цих конструкцій. Проводили транс-фекцію ракових клітин цими домінантнега-тивними конструкціями для пригнічення експресії ендогенних PFKFB-3 і PFKFB-4 та проліферації клітин. Встановлено, що експресія PFKFB-3 в клітинах карциноми підшлункової залози лінії Рапсі, стабільно трансфекованих dnPFKFB-3, знижується як у нормальних умовах, так і за гіпоксії. У клітинах з посиленою експресією dnPFKFB-
4 спостерігали пригнічення ендогенних як PFKFB-4 , так і PFKFB-3. Проліферація клітин карциноми підшлункової залози, стабільно трансфекованих як dnPFKFB-3, так
і dnPFKFB-4, знижується. Результати цих досліджень показують можливість використання домінантнегативних конструкцій PFKFB-3 та PFKFB-4 для зменшення інтенсивності гліколізу та проліферації ракових клітин шляхом зниження експресії ендогенних PFKFB.
Ключові слова: РЕКЕБ-4 мРНК, РЕКЕБ-3 мРНК, домінантнегативні конструкції, ракові клітини.
ДОМИНАНТНЕГАТИВНЫЕ КОНСТРУКЦИИ 6-ФОСФОФРУКТО-2-КИНАЗЫ/ФРУКТОЗО-2,6-БИСФОСФАТАЗЫ-3 И -4 ЧЕЛОВЕКА:
ВЛИЯНИЕ НА ЭКСПРЕССИЮ ЭНДОГЕННЫХ мРНК 6-ФОСФОФРУКТО-2-КИНАЗЫ/ФРУКТОЗО-2,6-БИСФОСФАТАЗ
Д. А. Минченко1 А. Ю. Бобарыкина1 О. А. Ратушна1 Р. Ю. Марунич1 K. Тсучигара2 М. Моне3 X. Каро4 Г. Есуми2 А. Г. Минченко1, 2
1Институт биохимии им. А. В. Палладина НАН Украины, Киев
2Научно-исследовательский центр инновационной онкологии Восточного госпиталя Национального онкологического центра Японии, Кашива, Япония
3INSERM U920 Лаборатория молекулярных механизмов ангиогенеза Университета Бордо 1, Таленс, Франция
4Отдел медицины Джефферсон медицинского колледжа Томас Джефферсон Университета, Филадельфия, США
E-mail: [email protected]
Экспрессия 6-фосфофрукто-2-киназы/ фруктозо-2,6-бисфосфатазы (PFKFB), ключевого регуляторного энзима гликолиза, резко возрастает в различных злокачественных опухолях, что раскрывает возможный механизм усиленного гликолиза в раковых клетках и их пролиферации. Мы создали доминантнегатив-ные конструкции кДНК 6-фосфофрукто-2-киназы/фруктозо-2,6-бисфосфатазы-3 и -4 (dnPFKFB-3 и dnPFKFB-4) для угнетения усиленной экспрессии эндогенных PFKFB-3
и PFKFB-4. Для этого вводили точечные мутации в АТР-связывающий домен 6-фосфофрук-то-2-киназы как PFKFB-3, так и pFкFB-4 для угнетения 6-фосфофрукто-2-киназной активности в продуктах экспрессии этих конструкций. Проводили трансфекцию раковых клеток этими доминантнегативными конструкциями для угнетения экспрессии эндогенных PFKFB-
3, а также пролиферации клеток. Установлено, что экспрессия PFKFB-3 в клетках карциномы поджелудочной железы линии Рапс1, стабильно трансфецированных dnPFKFB-3, снижается как в нормальных условиях, так и при гипоксии. В клетках с усиленной экспрессией dnPFKFB-4 наблюдали угнетение эндогенных как PFKFB-4, так и PFKFB-3. Пролиферация клеток карциномы поджелудочной железы, стабильно трансфецированных как dnPFKFB-3, так и dnPFKFB-4, снижается. Результаты этих исследований показывают возможность использования доминантнегатив-ных конструкций PFKFB-3 и PFKFB-4 для уменьшения интенсивности гликолиза и пролиферации раковых клеток путем снижения экспрессии эндогенных PFKFB.
Ключевые слова: РЕКЕБ-3 и РЕКЕБ-4 мРНК, до-минант-негативные конструкции, раковые клетки.
