CC BY
0DIVERSITY OF PHYTOPATHOGENIC FUNGI IN COTTON
FIELDS OF UZBEKISTAN
1Khamdullayev Sh.A., 2Sherimbetov A.G., 3Bozorov T.A.
1,2,3Institute of Genetics and Experimental Biology of Plants, Academy of Sciences of the Republic of Uzbekistan, Tashkent region, Uzbekistan https://doi. org/10.5281/zenodo. 14160746
Abstract. This study investigates the diversity of phytopathogenic fungi affecting cotton (Gossypium spp.) in Uzbekistan, with a specific focus on identifying Fusarium oxysporum f.sp. vasinfectum (FOV) race 4. Soil and plant samples were collectedfrom cotton fields across various regions, including Samarkand, Bukhara, Navoi, and Namangan. Morphological, systematic, biological, and molecular genetic analyses were conducted on the isolated fungal cultures. The results revealed the presence of multiple Fusarium species, including F. oxysporum, F. solani, F. brachygibbosum, F. verticillioides, F. globosum, F. equiseti, and F. proliferatum. Among the 20 FOV strains isolated, 11 were identified as race 4, indicating a significant threat to cotton production. The study highlights the urgent need for effective management strategies to control FOV and the importance of developing resistant cotton varieties to mitigate the impact of fusarium wilt on crop yield.
Keywords: race 4, Fungi, Fusarium oxysporum, phytopathogenic cotton, fungal diversity, molecular identification.
Introduction
Cotton is one of the most important agricultural crops in Uzbekistan, contributing significantly to the country's economy. However, its cultivation faces numerous challenges, including various biotic stress factors that threaten crop yields. Among these, phytopathogenic fungi play a crucial role in causing significant economic losses. These pathogens can affect cotton plants at different growth stages, leading to reduced fiber quality and yield.
Phytopathogenic fungi, including species from the Fusarium are some of the most destructive pathogens affecting cotton in Uzbekistan. In particular, Fusarium oxysporum f.sp. vasinfectum (FOV), responsible for Fusarium wilt, has become a critical concern for cotton producers.
Understanding the diversity of these pathogens is essential for developing resistant cotton varieties and implementing effective management strategies. This study aims to investigate the diversity of phytopathogenic fungi in cotton fields across Uzbekistan and focus on the detection and characterization of FOV race 4. By identifying the prevalence and distribution of these pathogens, this research will provide valuable insights into the disease ecology of cotton in the region and help guide breeding programs toward more resilient cotton varieties.
Literature Review
Fusarium wilt affects many crop species worldwide, caused by Fusarium oxysporum, which is transmitted through seeds and soil. In cotton plants, the pathogen responsible is Fusarium oxysporum f. sp. vasinfectum (FOV). This pathogen was first isolated in 1892 from samples collected in Alabama and Arkansas [4]. FOV is characterized by various races [3], vegetative compatibility groups (VCGs), and several genotypes of the pathogen. In the United States, races 1, 2, 3, 4, 6, and 8 of FOV have been identified [5, 6, 7, 8, 11].
Smith (2015) discovered that multiple races or genotypes of the pathogen can be present in a single cotton field [18]. However, interactions between FOV races in crop fields are still poorly understood. Some races, such as FOV race 4, can cause severe damage to the cotton plant within the first few weeks of development, while others may affect the plant throughout the growing season [12].
In Uzbekistan and other Central Asian countries, Fusarium species, which previously only infected fine-fiber cotton (Gossypium barbadense), began appearing on medium-fiber cotton (Gossypium hirsutum) varieties starting in the 1970s. By now, this disease has become one of the major issues in cotton farming. In recent years, a particularly alarming phytosanitary situation has emerged in several districts of Bukhara region, where Fusarium wilt has spread significantly, leading to the loss of40-50% of cotton seedlings in affected fields. Research indicates that in 2012, Fusarium wilt caused seedling mortality rates exceeding 71%, from the appearance of the first true leaves to the opening of the first boll [20]. In some farms, crop loss due to Fusarium wilt reached 85% [1, 10, 15].
Identifying species, races, and genotypes of Fusarium, as well as evaluating their virulence, enables effective control of these pathogens and aids in the prevention of crop damage. Furthermore, this knowledge facilitates the introduction of resistant cotton varieties to mitigate the impact of Fusarium wilt on agricultural production.
Materials and Methods
In mycological studies, the shapes and sizes of macroconidia and microconidia of fungi were determined using a binocular microscope. The species composition of fungal cultures was identified using specialized keys [14].
DNA extraction from the isolated fungal samples was performed using the "Invitrogen PureLink™ Genomic DNA Mini Kit" (Thermo Fisher, USA) reagents. The extracted DNA samples were amplified using primers (Table 1) targeting the TEF-1a (translation elongation factor 1a), TUBB (P-tubulin) genes, and the ITS1, ITS4 (internal transcribed spacers of the nuclear rDNA region).
A panel of markers was used to detect race 4 among the isolated fungal strains and identify the insertion of the T/O1 transposon into the PHO gene.
PCR products were purified, and the identity of the isolates was determined by Sanger sequencing of the ITS region and TEF-1a and TUBB gene fragments. The resulting nucleotide sequences were processed and compared with sequences of Fusarium species in the NCBI database to accurately identify the species of the examined isolates (Table 1).
Table 1. DNA marker panel for identifying fungal species and specializedforms
№ Primer name Primer sequence (Forward/Reverse) Reference
1. TEF1-a TGCGGTGGTATCGACAAGCGT/ AGCATGTTGTCGCCGTTGAAG Jacobs et al., 2004 [13]
2. TUBB GGTAACCAAATCGGTGCTGCTTTC / ACCCTCAGTGTAGTGACCCTTGGC Pavlic et al. 2009 [17]
3. ITS1, ITS4 TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC White et al., 1990 [19]
4. Race 4 (R4f, R4r) GCTCCGTGTCWGAGCTTCTT/ TGCTCATCGTGGAGCATAAC Yang et al., 2006 [21]
Results
Samples of cotton varieties and soils were collected from the regions of Uzbekistan, including Samarkand (Narpay), Bukhara (Vobkent), Navoi (Navbahor), Jizzakh (Sharof Rashidov), Syrdarya (Saykhunobod), Tashkent (Quyichirchiq), Andijan (Ulugnor), Fergana (Besharik), and Namangan (Pop), for mycological analysis. Phytosanitary inspections of cotton fields revealed the presence of disease symptoms in plant organs, including root rot, collar rot, leaf spotting, stem wilting, and various types of lesions (Pic. 1).
Soil samples collected from depths of 10, 20, and 30 cm, as well as samples from diseased plants, were subjected to mycological examination under laboratory conditions.
Navoi region
Pic. 1. Infected plants in the cotton fields of Bukhara and Navoi regions To identify the species of the isolated fungi, monosporic isolates were subjected to morphological analysis, and molecular genetic identification was performed based on the nucleotide sequences of the ITS regions and fragments of the TEF-1a and TUBB genes.
Table 2. Fungal species isolated as a result of mycological examination
№ The region where the fungi were isolated From plant samples From soil samples
F. oxysporum F. oxysporum
1. Namangan F.solani F.solani
Aspergillus nidulans
F. oxysporum F. oxysporum
2. Fergana F. brachygibbosum
F. verticillioides
3. Andijan F. oxysporum F. oxysporum
F. globosum
4. Syrdarya F. oxysporum F. oxysporum
Aspergillus nidulans
F. brachygibbosum
5. Samarkand F. oxysporum F. oxysporum
F. brachygibbosum
Chaetomium jodhpurense
6. Navoi F. oxysporum F. oxysporum
Striaticonidium brachysporum
Aspergillus nidulans
7. Bukhara F. oxysporum F. oxysporum
F.proliferatum F. equiseti
F.proliferatum
Aspergillus nidulans
Chaetomium globosum
As a result of the mycological examination, soil samples from all the studied regions revealed the presence of Fusarium species, including F. oxysporum, F. solani, F. brachygibbosum, F. verticillioides, F. globosum, F. equiseti, and F. proliferatum, as well as other fungal species such as Aspergillus nidulans, Chaetomium globosum, Chaetomium jodhpurense, and Striaticonidium brachysporum. In plant samples, F. oxysporum was frequently detected, while in Namangan region, F. solani was found to infect cotton seedlings.
The polymerase chain reaction (PCR) analysis was conducted using a DNA marker panel to identify race 4 among the isolated F. oxysporum f.sp. vasinfectum (FOV) strains (Pic 2). Out of 20 FOV strains, 11 (1-FOV IGPEB-SH1, 2-FOV IGPEB-SH2, 4-FOV IGPEB-SH4, 7-FOV IGPEB-SH8, 9-FOV IGPEB-SH10, 10-FOV IGPEB-SH12, 11-FOV IGPEB-SH14, 12-FOV IGPEB-SH15, 13-FOV IGPEB-SH16, 17-FOV IGPEB-SH37, 18-FOV IGPEB-SH39) showed amplification of 208 bp with the Race 4 marker, indicating that these strains belong to race 4. These strains were isolated from cotton fields in Namangan, Samarkand, Navoi, and Bukhara regions.
bp L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 400 300
200
100
Pic 2. Description of gel electrophoresis image of PCR analysis of FOV strains using Race 4
(R4f R4r) specific DNA marker.
L-100 bp DNK marker, 1-FOV IGPEB-SH1, 2-FOV IGPEB-SH2, 3-FOVIGPEB-SH3, 4-FOV IGPEB-SH4, 5-FOV IGPEB-SH5, 6-FOV IGPEB-SH6, 7-FOV IGPEB-SH8, 8-FOV IGPEB-SH9, 9-FOV IGPEB-SH10, 10-FOV IGPEB-SH12, 11-FOV IGPEB-SH14, 12-FOV IGPEB-SH15, 13-FOV IGPEB-SH16, 14-FOVIGPEB-SH18, 15-FOVIGPEB-SH20, 16-FOVIGPEB-SH22, 17-FOV IGPEB-SH37, 18-FOVIGPEB-SH39,19-FOVIGPEB-SH46, 20-FOVIGPEB-SH51.
Discussion
In this study, we examined the diversity of phytopathogenic fungi affecting cotton in various regions of Uzbekistan, with a specific focus on identifying Fusarium oxysporum f.sp. vasinfectum (FOV) race 4. The findings highlight the significant presence of Fusarium species in
the soil and infected plant samples from the cotton fields in Bukhara, Navoi, and other regions, indicating a widespread issue that threatens cotton production.
Research has documented the presence of FOV races 1, 2, 3, 6, and 7 in Uzbekistan. The identification of FOV race 3 was achieved using allele-specific SNP primers based on nucleotide polymorphisms of the P-tubulin (BT) gene [10]. Our research utilized a protocol for detecting FOV race 4 with specific primer pairs R4F and R4R, as established by Yang et al. (2006). Consequently, among the 20 FOV strains isolated from cotton fields in Namangan, Samarkand, Navoi, and Bukhara regions, 11 were confirmed as race 4 [21].
The identification of F. oxysporum, F. solani, F. brachygibbosum, F. verticillioides, F. globosum, F. equiseti, and F. proliferatum in the soil samples demonstrates the complexity of the fungal communities present in these agricultural environments. This aligns with previous studies that reported similar fungal diversity in cotton-growing regions globally [3, 9, 11]. The identification of other fungal species such as Aspergillus nidulans and Chaetomium spp. further suggests potential competitive interactions and the ecological dynamics within the cotton agroecosystem.
The results of the PCR analysis using specific DNA markers for race 4 revealed that 11 out of the 20 isolated FOV strains amplified at 208 bp, confirming their classification as race 4. This is particularly concerning as race 4 has been known to cause significant damage to cotton plants, particularly in their early developmental stages, which can lead to substantial yield losses [2, 5, 9, 16]. The high incidence of race 4 strains found emphasizes the urgent need for effective management strategies to mitigate its impact on cotton production. Notably, race 4 is classified as an extremely virulent strain, capable of significant damage to cotton yields, and its proliferation in cotton fields is not dependent on nematodes.
The alarming increase in fusarium wilt cases observed in recent years, particularly in Bukhara region, underlines the necessity for continuous phytosanitary monitoring and the implementation of integrated disease management practices. The most effective method for controlling this FOV race is through the use of resistant cotton varieties.
Our findings also highlight the importance of developing and deploying resistant cotton varieties, as well as conducting further research into the virulence characteristics of different Fusarium races. Globally, identifying Fusarium species that cause significant damage to cotton and studying the diversity within species, as well as genotyping, enables not only the monitoring of these pathogens' future movements but also helps in understanding the origin and spread of isolates.
In conclusion, this study contributes to the understanding of the diversity and distribution of phytopathogenic fungi in Uzbekistan's cotton fields, particularly focusing on Fusarium oxysporum f.sp. vasinfectum race 4. Continued research and monitoring are essential for addressing the challenges posed by these pathogens and ensuring the sustainability of cotton production in the region.
Conclusion
Pure cultures of phytopathogenic fungi were isolated from cotton fields in various regions. The isolated cultures underwent morphological, systematic, biological, and molecular genetic identification. Among the 20 Fusarium oxysporum f.sp. vasinfectum strains analyzed, 11 were identified as belonging to race 4.
This study focused on investigating the diversity of phytopathogenic fungi affecting cotton
in Uzbekistan and identifying FOV race 4. The results indicate a widespread occurrence of
fusarium wilt in cotton fields and its impact on plant productivity, highlighting the need for
effective control measures and the development of resistant cotton varieties.
REFERENCES
1. Abdullaev A, Salahutdinov I, Kuryazov Z, Sh E, Rizaeva S, Ulloa M, Abdurakhmonov IY. 2011. Study on Fusarium wilt disease (F. oxysporum vasinfectum) in Upland cotton (G. hirsutum). In: Fifth World Cotton Research Conference; 2011 Nov 7-11; Mumbai, India.
2. Alois A. Bell, Aixing Gu, Jim Olvey, Tanya A. Wagner, Javlon J. Tashpulatov, Sandria Prom, Jose Quintana, Robert L. Nichols, and Jinggao Liu Detection and Characterization of Fusarium oxysporum f. sp. vasinfectum VCG0114 (Race 4) Isolates of Diverse Geographic Origins. Plant Disease • 2019 • 103:1998-2009 • https://doi.org/10.1094/PDIS-09-18-1624-RE
3. Armstrong, G. M., and Armstrong, J. K. 1978. A new race (race 6) of the cotton wilt Fusarium from Brazil. Plant Dis. Rep. 62:421-423.
4. Atkinson, G. F. 1892. Some diseases of cotton. Bull. Ala. Agric. Exp. Sta. 41:19-29.
5. Bell, A. A., Gu, A., Olvey, J., Wagner, T. A., Tashpulatov, J. J., Prom, S., Quintana, J., Nichols, R. L., and Liu, J. 2019. Detection and characterization of Fusarium oxysporum f. sp. vasinfectum VCG0114 (race 4) isolates from diverse geographic origins. Plant Disease 103:1998-2009.
6. Bell, A. A., Kemerait, R. C., Ortiz, C. S., Prom, S., Quintana, J., Nichols, R. L., and Liu, J. 2017. Genetic diversity, virulence, and Meloidogyne incognita interactions of Fusarium oxysporum isolates causing cotton wilt in Georgia. Plant Dis. 101:948-956.
7. Carbone I, Anderson JB, Kohn LM, 1999. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 3, 553-6.
8. Davis, R. D., Moore, N. Y., and Kochman, J. K. 1996. Characterization of a population of Fusarium oxysporum f. sp. vasinfectum causing wilt of cotton in Australia. Aust. J. Agric. Res. 47:1143-1156.
9. Dyer DR, Newman M and Lawrence KS (2022) Diversity and temporal distribution of Fusarium oxysporum f. sp. vasinfectum races and genotypes as influenced by Gossypium cultivar. Front. Fungal Bio. 3:1022761. doi: 10.3389/ffunb.2022.1022761.
10. Egamberdiev et al. Molecular Characterization of Uzbekistan Isolates of Fusarium oxysporum f. sp. vasinfectum. Journal of Plant Science & Molecular Breeding 2013 . DOI: 10.7243/20502389-2-3
11. Fernandez D, Assigbetse K, Dubois M-P, Geiger J-P, 1994. Molecular characterization of races and vegetative compatibility groups in Fusarium oxysporum f.sp. vasinfectum. Applied and Environmental Microbiology 60, 4039-46.
12. Hutmacher, R. B., Ulloa, M., Wright, S. D., Campbell, B. T., Percy, R., Wallace, T., et al. (2013). Elite upland cotton germplasm-pool assessment for fusarium wilt resistance in California. Agron. J. 105, 1635-1644. doi: 10.2134/agronj2013.0264
13. Jacobs K, Bergdahl DR, Wingfield MJ et al., 2004. Leptographiumwingfieldii introduced into North America and found associatedwith exotic Tomicus piniperda and native bark beetles.Mycological Research 108, 411-8
14. Leslie J.F., Summerell B.A (2006). The Fusarium Laboratory Manual // Ames, Iowa, USA, Blackwell Publishing, 2006. 1-388 pp.
15. Marupov A, Boijigitiv F and Irgasheva N: Fusarium wilt of cotton. AgroIlm 2012, 2(22):39-40 (in Russian).
16. Ortiz, C. S., Bell, A. A., Magill, C. W., and Liu, J. 2017. Specific PCR detection of Fusarium oxysporum f. sp. vasinfectum California race 4 based on a unique T/o1 insertion event in the PHO gene. Plant Disease 101:34-44.
17. AKBARXODJAYEVA, F. (2024). OMMAVIY AXBOROT VOSITALARIDA TIBBIYOT TERMINLARINING VOQELANISHIGA DOIR QARASHLAR. News of UzMU journal, 1(1.4), 264-270.
18. Akbarxodjayeva, F. (2021). ТИББИЁТ ТЕРМИНОЛОГИЯСИ МУРАККАБ ТИЗИМ СИФАТИДА: ТИББИЁТ ТЕРМИНОЛОГИЯСИ МУРАККАБ ТИЗИМ СИФАТИДА. Журнал иностранных языков и лингвистики, 4(9).
19. AKBARXODJAEVA, F. A. (2021). Requirements for adopted terms in the field of medicine. THEORETICAL & APPLIED SCIENCE Учредители: Теоретическая и прикладная наука, 9, 230-233.
20. Rasulovna, H. M. (2023). USE OF MODERN TECHNOLOGIES IN TEACHING FOREIGN LANGUAGES. Journal of Innovation, Creativity and Art, 79-81.
21. Pavlic D, Slippers B, Coutinho TA, Wingfield MJ. Multiple gene genealogies and phenotypic data reveal cryptic species of the Botryosphaeriaceae: a case of study on the Neofusicoccum parvum/N. ribis complex. Mol Phylogen Evol. 2009;51:259-268.
22. Smith, A. L. (2015). Identification of resistant or tolerant commercial cotton cultivars to the fusarium wilt root-knot nematode disease complex and the identification Fusarium oxysporum f. sp. vasinfectum races in Alabama (Auburn (AL: Auburn University). Available at: http://hdl.handle.net/10415/4563.
23. White TJ, Bruns T, Lee S, Taylor J, 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Snisky JJ, White TJ, eds. PCR Protocols: a Guide to Methods and Applications. San Diego, CA, USA: Academic Press, 315-22.
24. Khasanov B.A. Fusarium Wilt cotton and contemporary methods of identification of fungi in the genus Fusarium // Monograph. Otdel "Tahririyat-Nashriyot" TashGAU, Tashkent, 2017, 136 p. (in Russian).
25. Yang, M. E., Davis, U., and Hutmacher, R. B. 2006. Fusarium wilt of cotton in California: characterization and PCR-based Detection of race 4. Pages 93-96 in: Proceeding of the Beltwide Cotton Conference. C. P. Dugger and D. A. Richter eds. National Cotton Council of America, Cordova TN.
