CC BY
11
DISTRIBUTION OF HAPLOGROUP G-P15 OF THE Y-CHROMOSOME AMONG REPRESENTATIVES OF ANCIENT CULTURES AND MODERN POPULATIONS OF NORTHERN EURASIA
E.K. Khusnutdinova1'2*, N. V. Ekomasoval'2, M.A. Dzhaubermezov1'2, L.R. Gabidullina1, Z.R. Sufianova1, I.M. Khidiyatova1'2, A.V. Kazantseva1'2, S.S. Litvinov1'2, A.Kh. Nurgalieva1, D.S. Prokofieva1
1 Federal State Educational Institution of Higher Education «Ufa University of Science and Technology», 32 Zaki Va-lidi St., Ufa, 450076, Russia;
2 Institute of Biochemistry and Genetics, Ufa Federal Research Center of the Russian Academy of Sciences, 71 Prospekt Oktyabrya St., Ufa, 450054, Russia.
* Corresponding author: elzakh@mail.ru
Abstract. The Alans represent a medieval nomadic pastoral people of the North Caucasus, who settled in Europe as a result of the Great Migration of Peoples. The genetic data of the Alans of the early Middle Ages and their relationship with the ancient and modern European populations remain insufficiently studied. It is assumed that the haplogroup G-P15 of the Y-chromosome was introduced in the Alans as a result of admixture with the autochthonous populations of the Caucasus. However, the impact of the Alan gene pool on the Medieval European populations appears to be unlikely, which may also indicate the absence of a significant genetic flow from steppe populations to European populations during the early Middle Ages.
Keywords: Y-chromosome, haplogroup, ancient DNA, human, population genetics.
Introduction
In recent years, a great interest toward the study of the ancient DNA samples has been detected worldwide. This was facilitated by the development of technologies that significantly improve the processes of purification, DNA isolation and bioinformatic analysis of the obtained nucleotide sequences, which almost completely excludes false results, as well as the awarding of the Nobel Prize in Physiology and Medicine in 2022 to Svante Paabo known as the founder of paleogenomics and one of the major evolutionary biologists in the world. This provided in recent decades a significant accumulation of genetic data on the ancient cultures, which have been previously examined exclusively by the methods of anthropology, archeology, and history. Considering the available data on the autosomal genome and mtDNA and Y-chromosome haplogroups in contemporary populations, the study of the continuity of the ancient cultures and nowadays populations inhabiting the same geographical regions, but separated in time period became one of the most challenging directions. The Y-chromosome as a
population-genetic marker used to examine a genetic history has several advantages. Together with the X-chromosome, the Y-chromosome is one of two sex chromosomes in male genome. It is much larger in size than mtDNA and its length is assigned to 60 kb, which indicates the possibility of higher number of polymorphic sites. A decreased level of homology to the X-chromosome is related to a low number of pseudoautosomal telomeric regions, which do not exceed 5%, and the presence of the original non-recombining region (NRY) comprising 95% of the total length. The NRY is the most examined region by population geneticists in phylogenetic studies, since this region is a single linkage group inherited as a single locus and together with mtDNA it represents a unip-arental marker, which is paternally transmitted to the male descendants. The Y-chromosome as an object of research by evolutionary geneticists is very promising in the upcoming era of next-generation sequencing of the human genome, and, consequently, a detection of novel markers inside the haplogroups. A geographical distribution of the Y-chromosome is affected
by both genetic and social-demographic factors; in this regard, another prompt of the Y-chromosome markers such as patrilocality should be noted: in 70% of nowadays societies a woman moves to her husband's place of residence (Jobling et al., 2003). This is an important factor that increases genetic subdivision of populations according to the Y-chromosome data. However, it should be noted that global movements are mainly characteristic for men. This is primarily caused by conquest wars, for example, in South America (Bedoya et al., 2006), apparently related to enhanced aggression (Strous et al., 2003) and the search for novel locations observed in men.
The Alans represent an extremely interesting culture, which monuments are still preserved on the territory of the Caucasus. The first mentions of the Alans appear almost simultaneously in the texts of different authors from various regions (Alemany, 2000). A major part of the Alans settled in the Northern Pre-Caucasus in the first century A.D. and eventually developed an early feudal state, which competed with the Khazar Khaganate and Byzantium at various stages of its development. However, there is no generally accepted hypothesis regarding the affiliation of the Alan language (Abu-Ali Ahmed Ben Omar Ibn-Dast, 1869; Miller, 1893; Aba-yev, 1949; Abu Reyhan Biruni, 1957; Nemet, 1960; Kuznetsov, 1962; Kuznetsov, 1968; Byazyrov, 1981; Kumekov, 1987; Tsutsiev, 1999; Abu-l-Fida, 2002; Kambolov, 2006; Konovalova, 2009; Dobrovits, 2011; Cheng, 2012; Basayev, 2013; Tuallagov, 2014; Tualla-gov, 2015a; Tuallagov, 2015b; Tuallagov, 2018; Kambolov, 2021). Currently, a large number of hypotheses on the language affiliation of the Alans exist; however, three main hypotheses that are the most popular among specialists can be selected:
1) The theory of Iranian (Ossetian) language origin of the Alans. To date, a majority of scientists support this hypothesis. This hypothesis is mainly referred to three late written sources: the Theology of John Thats, the Zelenchuk Inscription, and the Yass Glossary (Miller, 1893; Abayev, 1949; Nemet, 1960; Kuznetsov, 1962; Kuznetsov, 1968; Byazyrov, 1981; Kambolov,
2006; Basayev, 2013; Tuallagov, 2014; Tuallagov, 2015a; Tuallagov, 2015b; Tuallagov, 2018; Kambolov, 2021).
2) The theory of Turkic language origin of the Alans. The followers of this hypothesis mainly refer to written Arabic and Chinese sources, and to the Eastern European Turkic runic and onomastics of the Alan names (Abu-Ali Ahmed Ben Omar Ibn-Dast, 1869; Abu Reyhan Biruni, 1957; Abu-l-Fida, 2002; Dobrovits, 2011; Cheng, 2012).
3) The theory of mixed language origin of the Alans has been also discussed before; however, the development of molecular-genetic methods of analysis of the ancient DNA provided an increasing support by the specialists (Damgaard et al., 2018).
To date, the findings on only five samples belonging to this culture have been published (Afanasiev et al., 2014; Damgaard et al., 2018). One of them corresponds to haplogroup G, namely, to G-P15. Haplogroup G is the most common in the Caucasus and had the highest frequencies in North Osetins (69%) and Megrels (50%) (Kutuev et al., 2011; Yunusbayev et al., 2012). Its frequency decreases up to 5-15% in the Near and Middle East, and in Southern Europe (Rootsi et al., 2012). To date, there is convincing evidence obtained from the study of ancient DNA, which confirms a significant proportion of the haplog-roup G of the Y-chromosome in the Neolithic population of Central Europe. In particular, it was detected in four of six archaeological sites located in Spain, France, Italy, and Germany, and the total frequency of haplogroup G was more than 70% (Haak et al., 2008; Haak et al., 2010; Lacan et al., 2011a; Lacan et al., 2011b; Keller et al., 2012; Lee et al., 2012). Obviously, this observation points to the link between the presence of haplogroup G and the distribution of agriculture on the European continent (Semino et al., 2000a).
Materials and Methods
The study included DNA samples obtained from 29 Northern Eurasian populations, that were collected during 2002 to 2022, including Abazines, Abkhazes, Avars, Adyghes, Andis,
Bagvalals, Balkars, Darginians, Ingushes, Kabardines, Karachays, Lezgis, Megrels, Kara-nogays, Kuban Nogays, Kumyks, Osetins, Tabasarans, Chamalals, Cherkessians, Chechens, Altaians, Udmurts, Besermyans, Komi, Mari, Mordva, Chuvash, Bashkirs (from Perm Territory, Samara and Saratov region, Abzeli-lovsky, Sterlibashevsky, Baimaksky district of the Republic of Bashkortostan, Orenburg region), and two subpopulations of Tatars (from Tuymazinsky district of Bashkortostan and Kazan).
Ethnic background, ancestry and relative relationship were assigned using a questionnaire considering the data obtained from up to third generation. All the enrolled individuals were informed about the aim of the research. DNA isolation from the peripheral blood leukocytes was carried out via standard method of chloroform extraction (Mathew et al., 1984). The analysis of Y-chromosome markers was performed using a polymerase chain reaction (PCR) of DNA synthesis with corresponding oligonucleotide primers, restriction fragment length polymorphism (RFLP) and a direct Sanger's sequencing. The haplogroups of the Y-chromosome were assigned according to the updated classification of the Y-Chromosome Consortium (YCC) (YCC, 2002; Karafet, 2008).
To determine haplogroup G-M201 we used the following primers: F 5'-3' - tatgcatttgttgag-tatatgtc; R 5'-3'- gttctgaatgaaagttcaaacg, haplogroup G-P15: F 5'-3'- agagagttttctaacagggcg; R 5'-3'- tgggaatcacttttgcaact. Detected fragments 326 and 173 bp in length were analyzed using Sanger's sequencing on DNA Analyzer Applied Biosystems 3500 from the forward primer. Obtained chromatograms were examined using Sequenceher 5.1.
Results
The origin of haplogroup G-M201 is linked to a fairly large region, including Eastern Anatolia, Armenia and Western Iran (Rootsi et al., 2012). These regions were characterized by the highest diversity of the basal branches of the haplogroup G-M201 and STR haplotypes (Rootsi et al., 2012).
Haplogroup G-M201 is widespread in the Caucasus, the Near and Middle East, and Southern Europe. The highest frequency exceeding 70% was observed in the Caucasus, in North Ossetia and among the Svans (ethnic and territorial group of Georgians) (Balanovsky et al., 2011; Yunusbayev et al., 2012; Yardumian et al., 2017), while it's frequency is diminished up to 13% in Iranians and decreases toward the movement to the East (Regueiro et al., 2006). Haplogroup G-M201 has the frequencies ranging from 5 to 15% in the rest part of the Middle East, Southern Europe (especially in Italy and Greece), while its frequency drops in the Balkans and Northern Europe (Rootsi et al., 2012). However, it was almost absent in India. A subsequent movement toward East, obviously, evidences in the absence of migration of individuals bearing M-201 mutation (Sengupta et al., 2006).
As a result of the present study, we used 2972 DNA samples from the populations of Northern Eurasia (Volga-Ural region and the Caucasus). It was shown that haplogroup G-P15 was more frequent in the populations of the Caucasus and varied from 69.7% in the population of North Osetins up to 0% in the populations of Bagvalals, Tabasarans, Avars, and Armenians (Table 1). In the Volga-Ural region, haplogroup G-P15 occurs with the highest frequencies in the subpopulations of Kazan and Tuymazy Tatars (7.6% and 6%, respectively). Interestingly, in the subpopulations of Bashkirs, which were present in our study as eleven subpopulations from the Republic of Bashkortostan and neighboring regions, haplogroup G-P15 was detected only in three subpopulations such as Gaininsky Bashkirs, Abzelilovsky Bashkirs and Bashkirs from the Orenburg region (Table 1). It is also extremely interesting that this haplogroup is absent in several Volga-Ural populations. In particular, we failed to detect any sample bearing haplog-roup G-P15 in populations belonging to the Finno-Ugric linguistic group, which consisted of Udmurts, Komi, Mari, Mordva, and Besermyans in the present study.
Table 1
Distribution of the frequencies of Y-chromosome haplogroup G-P15 in the examined populations
Population N G2a-P15 (N) Frequency (%)
Chamalals 27 5 18.52
Andis 49 3 6.12
Lezgis 31 3 9.68
Darginians 67 2 2.98
Adyghes 154 72 46.75
Abazines 88 36 40.91
Karachays 69 22 31.88
Kumyks 73 10 13.7
Megrels 65 33 50.77
Abkhazes 162 77 47.53
Balkars 135 44 32.59
Cherkessians 126 57 45.24
Osetins N 132 92 69.7
Osetins S 21 10 47.62
Kabardines 140 60 42.86
Chechens 165 2 1.21
Nogays K 87 12 13.79
Karanogays 76 1 1.32
Ingushes 105 5 4.76
Avars 42 0 0
Bagvalals 28 0 0
Tabasarans 43 0 0
Armenians 26 0 0
Kurds 21 0 0
Tats 10 0 0
Bashkirs Sterlibashevsky District 54 0 0
Bashkirs Abzelilovsky District 82 1 1.22
Bashkirs Orenburg region (west) 45 1 2.22
Bashkirs Orenburg region (east) 34 0 0
Bashkirs Samara region 40 0 0
Bashkirs Saratov region 14 0 0
Bashkirs Perm Territory 71 1 1.4
Bashkirs Baimak 76 0 0
Bashkirs Abzelilovsky district of Bashkortostan 70 0 0
Bashkirs Burzyn distinkt of Bashkortostan 140 0 0
Chuvash 43 0 0
Komi 50 0 0
Mari 44 0 0
Mordva 59 0 0
Kazan Tatars 53 4 7.55
Tatars Tuymazinsky district of Bashkortostan 50 3 6
Udmurts 52 0 0
Besermyans 53 0 0
Discussion
The analyzed haplogroup G-P15, which has been previously detected in the Alans, is quite widely represented in both nowadays populations (Table 1) and certain samples of Neolithic archaeological cultures of Europe (Table 2). To be more precise, it was observed in Treilles culture, which refers to the Neolithic cultures that developed at the territory of nowadays France in the period from 2600 B.C. to 1700 B.C. Chronologically, this culture is
divided into three stages: early (2600-2300 BC), late (2300-2000 BC), and final (20001700 BC). The features of the funeral rite of Treilles culture were affected by the environment and are mainly present by dolmens and mounds (Balsan, 1972; Herrscher et al., 2013). The samples for the genetic analysis were obtained from the Treilles cave I at Saint-Jean-et-Saint-Paul (Fig. 1). The haplogroup G-P15 was detected in 20 of 22 examined male samples (Lacan et al., 2011).
Table 2
Y-chromosome haplogroup G-P15 in the ancient archaeological cultures
Culture Grouping Country Dating N P15 (N) Reference
Anatolian Aceramic Turkey 8300-7800 BC 1 1 Feldman et al., 2019
Sicily Italy 7000-1100 BC 16 3 Fernandes et al., 2020; Van de Loosdrecht et al., 2020
Anatolia_Neolithic Turkey 6424-6251 BC 8212-7952 BCE 12 Kilinc et al., 2016; Mathieson et al., 2015
Balkans_N Balkans_BA Balkans LCA Balkans_EBA Balkans_LN Balkans MP Neolithic Balkans 6000-2000 BC 90 30 Lipson et al., 2017; Mathieson et al., 2018; Olalde et al., 2018
Starcevo Hungary Croatia 5640-5540 BC 19 11 Szécsényi-Nagy et al., 2015
Anatolia_East_LC Anatolia Central LC Turkey 5592-5472 BP 14 2 Skourtanioti et al., 2020
ALPc_Szakalhat_MN Hungary 5300-4900 BC 2 2 Lipson et al., 2017
Epicardial Culture Spain 5000 BC 6 5 Lacan et al., 2011b
Iberia Spain 5000-500 BC 205 24 Olalde et al., 2019; Villalba-Mouco et al., 2019
Linear Pottery culture (LBK) France Hungary Germany Austria ~5000 BC 54 23 Brunel et al., 2020; Lipson et al., 2017; Rivollat et al., 2020; Nikitin et al., 2019; Szécsényi-Nagy et al. ,2015; Mathieson et al., 2018
Epicardial Culture Spain 5000 BC 6 5 Lacan et al., 2011b
Tisza Culture Hungary 5000-4500 BCE 3 1 Lipson et al., 2017
Table 2 continued
Culture Grouping Country Dating N P15 (N) Reference
Lengyel Culture Hungary 4800-4500 BCE 11 3 Szecsenyi-Nagy et al., 2015
France EIA France EN France_MN France_ENMN France EBA France_LIA France_EMBA France_LBA France HG France 4800-3000BC 123 42 Lacan et al., 2011a; Brunel et al., 2020; Rivollat et al., 2020
Lengyel Hungary 4800-4500 BC 12 3 Szecsenyi-Nagy et al., 2015
Sardinia_Bell_Beaker Sardinia_Neolithic Sardinia_Nuragic_BA Sardinia Chalcolithic Italy 4100-1000 BC 26 11 Fernandes et al., 2020
Trypillia Culture Ukraine 3758-3636 calBCE 9 5 Mathieson et al., 2018; Nikitin et al., 2017
Maykop Russia ~3500 BC 13 1 Wang et al., 2019; Key et al., 2020
Treilles culture / Final Neolithic France 3000 BC 22 20 Lacan et al., 2011a
Trentino Chalcolithic Trentino Bronze Age Trentino EBA Polada A Trentino Copper Age I Italy 3400-2100 calBC 8 3 Graefen et al., 2020
Néolithique France 3499-3126 calBC 5 4 Brunel et al., 2020
Horgen culture Switzerland 3323-2581 calBC 32 30 Furtwaengler et al., 2020
SE Iberia CA Spain 2900-2500 BCE 13 5 Olalde et al., 2019
Trentino Chalcolithic Italy 2891-2702 calBCE 1 1 Graefen et al., 2020
Bell_Beaker Hungary Germany Italy Great Britain Czech Republic 2800-1900 BC 27 3 Olalde et al., 2018; Fernandes et al., 2020
Unetice_EBA Czech Republic 2300-1700 BC 7 1 Olalde et al., 2018
Trentino Bronze Age Italy 2289-2141 calBC 1 1 Graefen et al., 2020
Trentino EBA Polada A Italy 2284-2136 calBC 2 1 Graefen et al., 2020
Anatolia_MLBA Assyrian IIIc Turkey ~2000-1750 BC 5 1 Damgaard et al., 2018
Koban Culture Russia VIII-VII BC 6 2 BoulyginaJ et al., 2020
Hallstatt Culture - Early «La Tène» France 800-700 calBC 5 1 Brunel et al., 2020
End of table 2
Culture Grouping Country Dating N P15 (N) Reference
Early Conqueror Upper Tisza Hungary first half of the tenth century CE 14 4 Fothi et al., 2020
Imperial Rome Italy 0-400 CE 24 5 Antonio et al., 2019
Wielbark culture Poland 100-300 AD 5 2 Stolarek et al., 2019
Sardinia_LateAntiquity Italy 256-403 calCE 2 1 Fernandes et al., 2020
Alan Russia 300-400 AD 5 1 Afanasiev et al., 2014; Damgaard et al., 2018
Hungary Avar Early Hungary VII AD 11 1 Neparâczki et al., 2019
Late Antiquity Rome Italy 300-700 CE 16 2 Antonio et al., 2019
Longobard Kingdom Italy 580-630 CE 17 1 Amorim et al., 2018
Alemannic Germany 580-630 CE 19 2 O' Sullivan et al., 2018; Veeramah et al., 2018
Merovingian Germany 670 CE 6 2 Vanek et al., 2009
Saltovo-Mayaki Russia 700-900 CE 11 1 Damgaard et al. , 2018; Afanasiev et al., 2015; Afanasiev et al., 2015
Medieval/Early Modern Rome Italy 1070-1430 calCE 6 3 Antonio et al., 2019
Late Kushnarenkovo-Karayakupovo Hungary X-XI AD 17 1 Csâky et al., 2020
Viking Sweden Russia Norway Estonia UK Denmark 700-1100 CE 276 3 Margaryan et al. , 2020; Krzewinska et al., 2018
Another major culture, which samples possessed the Y-chromosome haplogroup G-P15, is the Linear Pottery culture (LBK). This is one of the most examined Neolithic archaeological cultures of Europe (5500-4500 B.C.). It is assumed that agriculture and cattle breeding were widely distributed among the representatives of this culture. The funeral rite included both cre-mation and inhumation (Gimbutas,
1991). Ac-cording to the radiocarbon analysis, the samples from certain sites were dated to ~ 5000 B.C. The haplogroup G-P15 was observed in 23 of 54 analyzed male samples, which comprises 43% (Haak et al., 2010; Szécsényi-Nagy et al., 2015; Lipson et al., 2017; Mathieson et al., 2018; Rivollat et al., 2020). A specific interest is placed toward the Trypillia Culture representing a Neolithic and
Fig. 1. Location of archaeological sites with detected Y-chromosome haplogroup G-P15
Eneolithic culture (5500-2750 BC), that included the territories from nowadays Moldova, Romania, and Ukraine. The main hypotheses of the decline of this culture are the expansion of the Pit culture (Gimbutas, 1982) and the climate change (Videiko, 2002). The samples for the genetic analysis were obtained from the sites of Verteba Cave, Gläväne§ti, Mayaki, and Du-rankulak. A radiocarbon analysis dates the samples to 3900-3000 B.C. (Nikitin et al., 2017; Mathieson et al., 2018). The haplogroup G-P15 was detected in 5 of 9 examined male samples (Nikitin et al., 2017; Mathieson et al., 2018).
Another European culture, which is characterized by a high frequency of haplogroup G-P15, is the Starcevo culture. The Starcevo culture is an archaeological culture from the territory of South-Eastern Europe and dating back to the Neolithic period between 6200 and 4500 B.C. (Chapman, 2000). It is assumed that this culture was formed as a result of migration of Anatolian farmers; the western boundaries of the area of this culture are distributed till the territory of nowadays Croatia (Rajkovic and Vitezovic, 2020). The haplogroup G-P15 was detected in 11 of 19 analyzed male samples (Szecsenyi-Nagy et al., 2015).
Therefore, a predominance or high frequency of the Y-chromosome haplogroup G-P15 in representatives of various Neolithic archaeological cultures of Europe with a pronounced decrease or complete absence in the subsequent cultures confirms the hypothesis on Neolithic expansion of Anatolian/Middle Eastern farmers toward Western Europe, which was followed by their displacement by such steppe ancestors as pro-Indo-European steppe nomads.
In this regard, a specific interest belongs to the penetration of the East Eurasian steppe dwellers into the European continent during the early Middle Ages. Nomadic tribes carried out campaigns on the territory of European countries long before the beginning of the Great Migration of Peoples; however, a significant part of them insignificantly affected the culture of the indigenous population of the region. As an exception, we can mention the Alans, who appeared at the eastern border of Europe at the beginning of the New Era.
The earliest mention of the Alans in Western Europe belongs to the first half of the first century A.D. and their mention in Seneca's play. Even in the second half of the first century A.D., Josephus Flavius clarified that the Alans
were a Scythian people and occupied the territories from the Don to the Sea of Azov. Therefore, it may evidence in the penetration of the Alans into Europe. Later, they actively participated in the Great Migration of Peoples and were introduced to Gaul, Spain, and North Africa. In comparison to the previous and subsequent nomads, the Alans significantly contributed to the culture of European peoples. According to different authors, the European military culture owes the occurrence of chivalry to the Scythians and the Alans as their posterities, while the spiritual culture of Catholic Europe accepted the sermons of a number of priests (canonized later) originating from the Alan community. The Alans did not develop their own state on the European continent; however, they were assimilated by the local population by the V-VII centuries A.D. Accordingly, nowadays haplogroup G-P15 in Europe can be both a Neolithic marker and a consequence of medieval migrations.
Since the Alans are potentially Asian migrants, diminished frequencies of the haplog-roup G-P15 in nowadays populations of the VUR and its total absence in Finno-Ugric populations may indicate that this haplogroup was obtained by the Alans due to admixture with the autochthonous Caucasian population.
Conclusion
A distribution of haplogroup G is mainly limited to the territory of the Caucasus, the Near
and Middle East, as well as Southern Europe. Its maximal frequency is observed in Svaneti (78%) and North Ossetia (70%), decreases to 13-15% in Iran and is less common in Europe (Al-Zaheri et al., 2003; Luis et al., 2004; Gon-calves et al., 2005; Regueiro et al., 2006; Abu-Amero et al., 2007; King et al., 2008; Battaglia et al., 2009; Kutuev et al., 2011; Balanovsky et al., 2011; Rootsi et al., 2012; Yunusbayev et al., 2012; Khusnutdinova et al., 2012; Yar-dumian et al., 2017). Together with the haplog-roup J2, representation of this haplogroup is probably related to the spread of agriculture in Europe (Semino et al., 2000a; Rootsi et al., 2012).
A discovery of the haplogroup G-P15 in the graves belonging to the Alan culture evidence in the active admixture of steppe nomads with the settled autochthonous population of the Caucasus and in the possible further penetration of the Y-chromosomal genetic component from the Caucasus into Europe as a result of migration flows. However, to confirm this hypothesis, a detailed analysis of both the ancient and modern populations of mentioned regions of Western Eurasia is required.
Acknowledgments
This work has been supported by the grants of the Russian Science Foundation, RSF 22-24-00681.
References
ABAYEV V.I. (1949): The Ancient Ossetian Zelenchuk inscription. Ossetian language and folklore. Moscow: L. Publishing House of the USSR Academy of Sciences 1, 260-270. (In Russ.)
ABU REYHAN BIRUNI (1957). Selected works. V. I. Monuments of past generations. Tashkent: FAN of the Uzbek SSR 516 pp. (In Russ.)
ABU-ALI AHMED BEN OMAR IBN-DAST (1869): News about the Khazars, Burtas, Bulgarians, Magyars, Slavs and Russians by Abu-Ali Ahmed Bin Omar Ibn Dast, a hitherto unknown Arabic writer of the early X century, according to the manuscript of the British Museum, Imperial Academy of Sciences. St. Petersburg, 214 pp. (In Russ.)
ABU-AMERO K.K., GONZÁLEZ A.M., LARRUGA J.M., BOSLEY T.M. & CABRERA V.M. (2007): Eurasian and African mitochondrial DNA influences in the Saudi Arabian population. BMC evolutionary biology 7, 32. https://doi.org/10.1186/1471-2148-7-32.
ABU-L-FIDA. (2002): The book of ordering countries. Ancient and medieval sources on ethnography and history of sub-Saharan Africa. Arabic sources of the XIII-XIV centuries. Moscow: Oriental literature Vol. 4, 622 pp. (In Russ.)
AFANASIEV G.E., DOBROVOLSKAYA M.V., KOROBOV D.S. & RESHETOVA IK. (2014): On the cultural, anthropological and genetic specifics of the Don Alans. E.I. Krupnov and the development of
archeology of the North Caucasus. XXVIII Krupnov readings. Materials of the International Scientific Conference. Moscow: IA RAS, 312-315. (In Russ.)
AFANASIEV G.E., DOBROVOLSKAYA M.V., KOROBOV D.S. & RESHETOVA I.K. (2015): New archaeological, anthropological and genetic aspects in the study of the Don Alans. KSIA. 237, 64-79. (In Russ.)
AFANASIEV G.E., WEN SH., TUN S., WANG L., WEI L., DOBROVOLSKAYA M.V., KOROBOV D.S., RESHETOVA I.K. & LI H. (2015): Khazar Confederates in the Don Basin. Natural science research methods and the paradigm of modern archaeology. Moscow: IA RAS, 146-153. (In Russ.)
ALEMANY A. (2000): Sources on the Alans: A Critical Compilation. Brill.
AL-ZAHERI N., SEMINO O., BENUZZI G., MAGRI C., PASSARINO G., TORRONI A. & SAN-TACHIARA-BENERECETTI A. S. (2003): Y-chromosome and mtDNA polymorphisms in Iraq, a crossroad of the early human dispersal and of post-Neolithic migrations. Molecular phylogenetics and evolution 28(3), 458-472. https://doi.org/10.1016/s1055-7903(03)00039-3.
AMORIM C.E.G., VAI S., POSTH C., MODI A., KONCZ I., HAKENBECK S., LA ROCCA M.C., MENDE B., BOBO D., POHL W., BARICCO L. P., BEDINI E., FRANCALACCI P., GIOSTRA C., VIDA T., WINGER D., VON FREEDEN U., GHIROTTO S., LARI M., BARBUJANI G., ... VEERAMAH K.R. (2018): Understanding 6th-century barbarian social organization and migration through paleogenomics. Nature communications 9(1), 3547. https://doi.org/10.1038/s41467-018-06024-4.
ANTONIO ML., GAO Z., MOOTS H.M., LUCCI M., CANDILIO F., SAWYER S., OBERREITER V., CALDERON D., DEVITOFRANCESCHI K., AIKENS R.C., ANELI S., BARTOLI F., BEDINI A., CHERONET O., COTTER D. J., FERNANDES DM., GASPERETTI G., GRIFONI R., GUIDI A., LA PASTINA F., . PRITCHARD J.K. (2019): Ancient Rome: A genetic crossroads of Europe and the Mediterranean. Science 366(6466), 708-714. https://doi.org/10.1126/science.aay6826.
BALANOVSKY O., DIBIROVA K., DYBO A., MUDRAK O., FROLOVA S., POCHESHKHOVA E., HABER M., PLATT D., SCHURR T., HAAK W., KUZNETSOVA M., RADZHABOV M., BALAGANSKAYA O., ROMANOV A., ZAKHAROVA T., SORIA HERNANZ D.F., ZALLOUA P., KOSHEL S., RUHLEN M., RENFREW C., WELLS R.S., TYLER-SMITH C. & BALANOVSKA E. (2011): Parallel evolution of genes and languages in the Caucasus region. Molecular biology and evolution 28(10), 2905-2920. https://doi.org/10.1093/molbev/msr126.
BALSAN L. & COSTANTINI G. (1972): Étude archéologique et synthèse sur le Chalcolithique des Grands Causses - La grotte I des Treilles à Saint-Jean et Saint-Paul (Aveyron). Gallia préhistoire 15 (1), 229-250.
BASAYEV B.B., KUZNETSOV V A., TEMIRAEV V.H. & CHIBIROV L A. (2013): Part I. Zelenchuk inscription. Monuments of the Alano-Ossetian script. Vladikavkaz: Ir,. 12-153. ISBN 978-5-7534-1425-0. (In Russ.)
BATTAGLIA V., FORNARINO S., AL-ZAHERY N., OLIVIERI A., PALA M., MYRES N.M., KING R.J., ROOTSI S., MARJANOVIC D., PRIMORAC D., HADZISELIMOVIC R., VIDOVIC S., DROB-NIC K., DURMISHI N., TORRONI A., SANTACHIARA-BENERECETTI AS., UNDERHILL PA. & SEMINO O. (2009): Y-chromosomal evidence of the cultural diffusion of agriculture in Southeast Europe. European journal of human genetics: EJHG, 17(6), 820-830. https://doi.org/10.1038/ ejhg.2008.249.
BEDOYA G., MONTOYA P., GARCÍA J., SOTO I., BOURGEOIS S., CARVAJAL L., LABUDA D., ALVAREZ V., OSPINA J., HEDRICK P.W. & RUIZ-LINARES A. (2006): Admixture dynamics in His-panics: a shift in the nuclear genetic ancestry of a South American population isolate. Proceedings of the National Academy of Sciences of the United States of America 103(19), 7234-7239. https://doi.org/10.1073/pnas.0508716103.
BOULYGINA E., TSYGANKOVA S., SHARKO F., SLOBODOVA N., GRUZDEVA N., RAS-TORGUEV S. ... & NEDOLUZHKO A. (2020): Mitochondrial and Y-chromosome diversity of the prehistoric Koban culture of the North Caucasus. Journal of Archaeological Science: Reports 31, 102357. https://doi.org/ 10.1016/j .jasrep.2020.102357.
BRUNEL S., BENNETT E.A., CARDIN L., GARRAUD D., BARRAND EMAM H., BEYLIER A., BOUL-ESTIN B., CHENAL F., CIESIELSKI E., CONVERTINI F., DEDET B., DESBROSSE-DEGO-BERTIERE S., DESENNE S., DUBOULOZ J., DUDAY H., ESCALON G., FABRE V., GAILLEDRAT E., GANDELIN M., GLEIZE Y., . PRUVOST M. (2020): Ancient genomes from
present-day France unveil 7,000 years of its demographic history. Proceedings of the National Academy of Sciences of the United States of America 117(23), 12791-12798. https://doi.org/10.1073/ pnas.1918034117.
BYAZYROV A.H. (1981): Ossetian pedigree of the X century. Ossetian philology: a collection 2, 3-5. (In Russ.)
CHAPMAN J. (2000): Fragmentation in Archaeology: People, Places, and Broken Objects. London: Routledge. p. 237.
CHENG F. (2012): The Reseacrh and Identification Between Tiele and The Oguric Tribes. Archivum
Eurasiae Medii Aevi 19, Wiesbaden: Harrasowitz Verlag, 104-107.
CSÁKY V., GERBER D., SZEIFERT B., EGYED B., STÉGMÁR B., BOTALOV S.G., GRUDO-CHKO I.V., MATVEEVA N.P., ZELENKOV A.S., SLEPTSOVA A. V., GOLDINA R. D., DANICH A.V., MENDE B.G., TÜRK A. & SZÉCSÉNYI-NAGY A. (2020): Early medieval genetic data from Ural region evaluated in the light of archaeological evidence of ancient Hungarians. Scientific reports, 10(1), 19137. https://doi.org/10.1038/s41598-020-75910-z.
DAMGAARD P.B., MARCHI N., RASMUSSEN S., PEYROT M., RENAUD G., KORNELIUSSEN T., MORENO-MAYAR J. V., PEDERSEN M. W., GOLDBERG A., USMANOVA E., BAIMUKHA-NOV N., LOMAN V., HEDEAGER L., PEDERSEN A. G., NIELSEN K., AFANASIEV G., AK-MATOV K., ALDASHEV A., ALPASLAN A., BAIMBETOV G., ... WILLERSLEV E. (2018): 137 ancient human genomes from across the Eurasian steppes. Nature 557(7705), 369-374. https://doi.org/10.1038/s41586-018-0094-2.
DAMGAARD P., MARTINIANO R., KAMM J., MORENO-MAYAR J. V., KROONEN G., PEYROT M., BARJAMOVIC G., RASMUSSEN S., ZACHO C., BAIMUKHANOV N., ZAIBERT V., MERZ V., BIDDANDA A., MERZ I., LOMAN V., EVDOKIMOV V., USMANOVA E., HEMPHILL B., SE-GUIN-ORLANDO A., YEDIAY F. E., ... WILLERSLEV E. (2018): The first horse herders and the impact of early Bronze Age steppe expansions into Asia. Science 360(6396), eaar7711. https://doi.org/10.1126/science.aar7711.
DOBROVITS M. (2011): The Altaic World Through Byzantine Eyes: Some Remarks on the Historical Circumstances of Zemarchus' Journey to the Turks (AD 569-570). Acta Orientalia Academiae Scientiarum Hung 64 (4), 375-378.
FELDMAN M., FERNÁNDEZ-DOMÍNGUEZ E., REYNOLDS L., BAIRD D., PEARSON J., HERSHKOVITZ I., MAY H., GORING-MORRIS N., BENZ M., GRESKY J., BIANCO R. A., FAIR-BAIRN A., MUSTAFAOGLU G., STOCKHAMMER P. W., POSTH C., HAAK W., JEONG C. & KRAUSE J. (2019): Late Pleistocene human genome suggests a local origin for the first farmers of central Anatolia. Nature communications 10(1), 1218. https://doi.org/10.1038/s41467-019-09209-7.
FERNANDES D.M., MITTNIK A., OLALDE I., LAZARIDIS I., CHERONET O., ROHLAND N., MAL-LICK S., BERNARDOS R., BROOMANDKHOSHBACHT N., CARLSSON J., CULLETON B.J., FERRY M., GAMARRA B., LARI M., MAH M., MICHEL M., MODI A., NOVAK M., OPPENHEIMER J., SIRAK K. A., ... REICH D. (2020): The spread of steppe and Iranian-related ancestry in the islands of the western Mediterranean. Nature ecology & evolution 4(3), 334-345. https://doi.org/10.1038/s41559-020-1102-0.
FÓTHI E., GONZALEZ A., FEHÉR T, GUGORA A., FÓTHI A., BIRÓ O. & KEYSER C. (2020): Genetic analysis of male Hungarian Conquerors: European and Asian paternal lineages of the conquering Hungarian tribes. Archaeological and Anthropological Sciences 12, 31. https://doi.org/10.1007/s12520-019-00996-0.
FURTWÄNGLER A., ROHRLACH A. B., LAMNIDIS T. C., PAPAC L., NEUMANN G. U., SIEBKE I., REITER E., STEURI N., HALD J., DENAIRE A., SCHNITZLER B., WAHL J., RAMSTEIN M., SCHUENEMANN V. J., STOCKHAMMER P. W., HAFNER A., LÖSCH S., HAAK W., SCHIFFELS S. & KRAUSE J. (2020): Ancient genomes reveal social and genetic structure of Late Neolithic Switzerland. Nature communications 11(1), 1915. https://doi.org/10.1038/s41467-020-15560-x.
GIMBUTAS M. (1982): Old Europe in the Fifth Millennium B.C.: The European Situation on the Arrival of Indo-Europeans. The Indo-Europeans in the Fourth and Third Millennia BC, ed. Edgar C. Polomé. Ann Arbor: Karoma Publishers, 1 -60.
GIMBUTAS M. (1991): The civilization of the goddess: The world of Old Europe, Harper. 544 pp.
GONÇALVES R., FREITAS A., BRANCO M., ROSA A., FERNANDES AT., ZHIVOTOVSKY LA., UNDERHILL P.A., KIVISILD T. & BREHM A. (2005): Y-chromosome lineages from Portugal, Madeira and Açores record elements of Sephardim and Berber ancestry. Annals of human genetics 69(Pt 4), 443-454. https://doi.org/10.1111/j.1529-8817.2005.00161.x.
GRAEFEN A. (2020): Population genetic analysis of neolithic to bronze age human remains_ from Trentino-Alto Adige (Northern Italy). Dissertation, Johannes Gutenberg-Universität Mainz, 221 pp. https://doi.org/10.25358/0PENSCIENCE-3109.
HAAK W., BALANOVSKY O., SANCHEZ J. J., KOSHEL S., ZAPOROZHCHENKO V., ADLER C.J., DER SARKISSIAN CS., BRANDT G., SCHWARZ C., NICKLISCH N., DRESELY V., FRITSCH B., BALANOVSKA E., VILLEMS R., MELLER H., ALT K.W. & COOPER A. (2010): Ancient DNA from European early neolithic farmers reveals their near eastern affinities. PLoS biology 8(11), e1000536. https://doi.org/10.1371/iournal.pbio.1000536.
HAAK W., BRANDT G., DE JONG H.N., MEYER C., GANSLMEIER R., HEYD V., HAWKES-WORTH C., PIKE A.W., MELLER H. & ALT K.W. (2008). Ancient DNA, Strontium isotopes, and osteological analyses shed light on social and kinship organization of the Later Stone Age. Proceedings of the National Academy of Sciences of the United States of America 105(47), 18226-18231. https://doi.org/10.1073/pnas.0807592105.
HERRSCHER E., LHEUREUX J., GOUDE G., DABERNAT H. & DURANTHON F. (2013): Les pratiques de subsistance de la population Néolithique final de la grotte I des Treilles (commune de Saint-Jean-et-Saint-Paul, Aveyron), Préhistoires Méditerranéennes, Association pour la promotion de la préhistoire et de l'anthropologie méditerranéennes, p. 27.
JOBLING M.A. & TYLER-SMITH C. (2003): The human Y-chromosome: an evolutionary marker comes of age. Nature reviews. Genetics 4 (8), 598-612.
KAMBOLOV T.T. (2006): Chapter III. 3.3.1.1. Zelenchuk inscription // Essay on the history of the Ossetian language. Vladikavkaz: Ir, 166-178. ISBN 5-7534-0602-5. (In Russ.)
KAMBOLOV. T.T. Written monuments of the Alan language. Part 2. Lecture. ALANYAinform. Accessed: December 27, 2021. Archived on December 27, 2021. (In Russ.)
KARAFET T.M., MENDEZ F L., MEILERMAN M B., UNDERHILL P.A., ZEGURA S.L. & HAMMER M.F. (2008): New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. Genome research 18(5), 830-838. https://doi.org/10.1101/gr.7172008.
KELLER A., GRAEFEN A., BALL M., MATZAS M., BOISGUERIN V., MAIXNER F., LEIDINGER P., BACKES C., KHAIRAT R., FORSTER M., STADE B., FRANKE A., MAYER J., SPANGLER J., MCLAUGHLIN S., SHAH M., LEE C., HARKINS T. T., SARTORI A., MORENO-ESTRADA A., ... ZINK A. (2012): New insights into the Tyrolean Iceman's origin and phenotype as inferred by whole-genome sequencing. Nature communications 3, 698. https://doi.org/10.1038/ncomms1701.
KEY F.M., POSTH C., ESQUIVEL-GOMEZ LR., HÜBLER R., SPYROU M.A., NEUMANN G.U., FURTWÄNGLER A., SABIN S., BURRI M., WISSGOTT A., LANKAPALLI A. K., VÀGENE À. J., MEYER M., NAGEL S., TUKHBATOVA R., KHOKHLOV A., CHIZHEVSKY A., HANSEN S., BELINSKY A.B., KALMYKOV A., ... KRAUSE J. (2020): Emergence of human-adapted Salmonella enterica is linked to the Neolithization process. Nature ecology & evolution 4(3), 324-333. https://doi.org/10.1038/s41559-020-1106-9.
KHUSNUTDINOVA E.K., LITVINOV S.S., KUTUEV I.A., IUNUSBAEV B.B., KHUSAINOVA R.I., AKHMETOVA V.L., AHATOVA F.S., METSPALU E., ROOTSI S. & VILLEMS R. (2012): Gene pool of ethnic groups of the caucasus: results of integrated study of the Y-chromosome and mitochon-drial DNA and genome-wide data. Genetika 48(6), 750-761. (In Russ.)
KILINÇ GM., OMRAK A., ÖZER F., GÜNTHER T., BÜYÜKKARAKAYA A.M., BIÇAKÇI E., BAIRD D., DÖNERTAS H.M., GHALICHI A., YAKA R., KOPTEKIN D., AÇAN S C., PARVIZI P., KRZEWINSKA M., DASKALAKI E.A., YÜNCÜ E., DAGTAS N.D., FAIRBAIRN A., PEARSON J., MUSTAFAOGLU G., ... GÖTHERSTRÖM A. (2016): The Demographic Development of the First Farmers in Anatolia. Current biology: CB 26(19), 2659-2666. https://doi.org/10.1016/ j.cub.2016.07.057.
KING R J., OZCAN S.S., CARTER T., KALFOGLU E., ATASOY S., TRIANTAPHYLLIDIS C., KOU-VATSI A., LIN A.A., CHOW C.E., ZHIVOTOVSKY LA., MICHALODIMITRAKIS M. & UNDERHILL P.A. (2008): Differential Y-chromosome Anatolian influences on the Greek and Cretan Neolithic. Annals of human genetics 72(Pt 2), 205-214. https://doi.org/10.1111/j.1469-1809.2007.00414.x.
KONOVALOVA I.G. (2009): Eastern Europe in the writings of Arab geographers of the XII-XIII centuries: Text; Translation; Comments. - Moscow: «Oriental Literature» RAS, p. 27. (In Russ.)
KRACHKOVSKY I.YU. (2004): Arabic geographical literature. Moscow, 29, 129, 192, 277, 327, 352, 359, 377, 382—386, 491, 493, 502, 598, 662 pp. (In Russ.)
KRZEWINSKA M., KJELLSTRÖM A., GÜNTHER T., HEDENSTIERNA-JONSON C., ZACHRIS-SON T., OMRAK A., YAKA R., KILINC G. M., SOMEL M., SOBRADO V., EVANS J., KNIPPER C., JAKOBSSON M., STORÄ J. & GÖTHERSTRÖM A. (2018): Genomic and Strontium Isotope Variation Reveal Immigration Patterns in a Viking Age Town. Current biology: CB, 28(17), 2730-2738.e10. https://doi.org/10.10167j.cub.2018.06.053.
KUMEKOV B.E. (1987): Arabic and Persian sources on the history of the Kipchaks of the VIII-XIV centuries: scientific and analytical review. Publishing house Nauka of the Kazakh SSR, 40 pp. (In Russ.)
KUTUEV I.A. & KHUSNUTDINOVA E.K. (2011): Genetic structure and molecular phylogeography of the peoples of Eurasia. Ufa, AN RB, Gilem, 240 pp. (In Russ.)
KUZNETSOV V.A. (1962): Alan tribes of the North Caucasus. Moscow: USSR Academy of Sciences, 134 pp. (In Russ.)
KUZNETSOV V.A. (1968): New data on the Zelenchuk inscription of the X century. Izvestia SONII. Or-dzhonikidze, Vol. XXVII, 193-199. (In Russ.)
LACAN M., KEYSER C., RICAUT F. X., BRUCATO N., DURANTHON F., GUILAINE, J., CRUBEZY E. & LUDES B. (2011a): Ancient DNA reveals male diffusion through the Neolithic Mediterranean route. Proceedings of the National Academy of Sciences of the United States of America 108(24), 97889791. https://doi.org/10.1073/pnas.1100723108.
LACAN M., KEYSER C., RICAUT F. X., BRUCATO N., DURANTHON F., GUILAINE J., CRUBEZY E. & LUDES B. (2011): Ancient DNA reveals male diffusion through the Neolithic Mediterranean route. Proceedings of the National Academy of Sciences of the United States of America 108(24), 97889791. https://doi.org/10.1073/pnas.1100723108.
LACAN M., KEYSER C., RICAUT F. X., BRUCATO N., TARRÜS J., BOSCH A., GUILAINE J., CRUBEZY E. & LUDES B. (2011b): Ancient DNA suggests the leading role played by men in the Neolithic dissemination. Proceedings of the National Academy of Sciences of the United States of America 108(45), 18255-18259. https://doi.org/10.1073/pnas.1113061108.
LACAN M., KEYSER C., RICAUT F. X., BRUCATO N., TARRÜS J., BOSCH A., GUILAINE J., CRUBEZY E. & LUDES B. (2011): Ancient DNA suggests the leading role played by men in the Neolithic dissemination. Proceedings of the National Academy of Sciences of the United States of America 108(45), 18255-18259. https://doi.org/10.1073/pnas.1113061108.
LEE E.J., MAKAREWICZ C., RENNEBERG R., HARDER M., KRAUSE-KYORA B., MÜLLER S., OSTRITZ S., FEHREN-SCHMITZ L., SCHREIBER S., MÜLLER J., VON WURMB-SCHWARK N. & NEBEL A. (2012): Emerging genetic patterns of the European Neolithic: perspectives from a late Neolithic Bell Beaker burial site in Germany. American journal ofphysical anthropology 148(4), 571-579. https://doi.org/10.1002/ajpa.22074.
LIPSON M., SZECSENYI-NAGY A., MALLICK S., POSA A., STEGMÄR B., KEERL V., ROHLAND N., STEWARDSON K., FERRY M., MICHEL M., OPPENHEIMER J., BROOMANDKHOSHBACHT N., HARNEY E., NORDENFELT S., LLAMAS B., GUSZTÄV MENDE B., KÖHLER K., OROSS K., BONDÄR M., MARTON T., ... REICH D. (2017): Parallel palaeogenomic transects reveal complex genetic history of early European farmers. Nature 551(7680), 368-372. https://doi.org/10.1038/na-ture24476.
LUIS JR., ROWOLD D.J., REGUEIRO M., CAEIRO B., CINNIOGLU C., ROSEMAN C., UN-DERHILL P.A., CAVALLI-SFORZA L.L. & HERRERA R.J. (2004): The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations. American journal of human genetics 74(3), 532-544. https://doi.org/10.1086/382286.
MARGARYAN A., LAWSON D.J., SIKORA M., RACIMO F., RASMUSSEN S., MOLTKE I., CAS-SIDY L.M., J0RSBOE E., INGASON A., PEDERSEN M. W., KORNELIUSSEN T., WILHELM-SON H., BUS M. M., DE BARROS DAMGAARD P., MARTINIANO R., RENAUD G., BHERER C., MORENO-MAYAR J.V., FOTAKIS A.K., ALLEN M., ... WILLERSLEV E. (2020): Population genomics of the Viking world. Nature 585(7825), 390-396. https://doi.org/10.1038/s41586-020-2688-8.
MATHEW C.G. (1984): The isolation of high molecular weight eukaryotic DNA. Methods in molecular biology 2, 31-34. https://doi.org/10.1385/0-89603-064-4:31.
MATHIESON I., ALPASLAN-ROODENBERG S., POSTH C., SZÉCSÉNYI-NAGY A., ROHLAND N., MALLICK S., OLALDE I., BROOMANDKHOSHBACHT N., CANDILIO F., CHERONET O., FER-NANDES D., FERRY M., GAMARRA B., FORTES G.G., HAAK W., HARNEY E., JONES E., KEATING D., KRAUSE-KYORA B., KUCUKKALIPCI I., ... REICH D. (2018): The genomic history of southeastern Europe. Nature 555(7695), 197-203. https://doi.org/10.1038/nature25778.
MATHIESON I., LAZARIDIS I., ROHLAND N., MALLICK S., PATTERSON N., ROODENBERG S. A., HARNEY E., STEWARDSON K., FERNANDES D., NOVAK M., SIRAK K., GAMBA C., JONES E. R., LLAMAS B., DRYOMOV S., PICKRELL J., ARSUAGA J. L., DE CASTRO J. M., CAR-BONELL E., GERRITSEN F., ... REICH D. (2015): Genome-wide patterns of selection in 230 ancient Eurasians. Nature, 528(7583), 499-503. https://doi.org/10.1038/nature16152.
MILLER V.F. (1893): Ancient Ossetian monument from the Kuban region. Materials on the archeology of the Caucasus. Moscow, 3, 110-118. (In Russ.)
NEMET YU. (1960): List of words in the language of Yass, Hungarian Alan. Translated from German and notes by V. I. Abaev. Ordzhonikidze: Ossetian Research Institute, p. 8. (In Russ.)
NEPARÂCZKI E., MAROTI Z., KALMÂR T., MAÀR K., NAGY I., LATINOVICS D., KUSTÀR Â., PÀLFI G., MOLNÂR E., MARCSIK A., BALOGH C., LÖRINCZY G., GÂL S. S., TOMKA P., KO-VACSOCZY B., KOVÂCS L., RASKO I. & TÖRÖK T. (2019): Y-chromosome haplogroups from Hun, Avar and conquering Hungarian period nomadic people of the Carpathian Basin. Scientific reports, 9(1), 16569. https://doi.org/10.1038/s41598-019-53105-5.
NIKITIN AG., POTEKHINA I., ROHLAND N., MALLICK S., REICH D. & LILLIE M. (2017): Mitochondrial DNA analysis of eneolithic trypillians from Ukraine reveals neolithic farming genetic roots. PloS one 12(2), e0172952. https://doi.org/10.1371/journal.pone.0172952.
NIKITIN AG., STADLER P., KOTOVA N., TESCHLER-NICOLA M., PRICE T.D., HOOVER J., KENNETT D.J., LAZARIDIS I., ROHLAND N., LIPSON M. & REICH D. (2019): Interactions between earliest Linearbandkeramik farmers and central European hunter gatherers at the dawn of European Ne-olithization. Scientific reports 9(1), 19544. https://doi.org/10.1038/s41598-019-56029-2.
OLALDE I., BRACE S., ALLENTOFT M.E., ARMIT I., KRISTIANSEN K., BOOTH T., ROHLAND N., MALLICK S., SZÉCSÉNYI-NAGY A., MITTNIK A., ALTENA E., LIPSON M., LAZARIDIS I., HARPER T.K., PATTERSON N., BROOMANDKHOSHBACHT N., DIEKMANN Y., FALTYSKOVA Z., FERNANDES D., FERRY M., ... REICH D. (2018): The Beaker phenomenon and the genomic transformation of northwest Europe. Nature 555(7695), 190-196. https://doi.org/10.103 8/nature25738.
OLALDE I., MALLICK S., PATTERSON N., ROHLAND N., VILLALBA-MOUCO V., SILVA M., DU-LIAS K., EDWARDS C. J., GANDINI F., PALA M., SOARES P., FERRANDO-BERNAL M., ADAMSKI N., BROOMANDKHOSHBACHT N., CHERONET O., CULLETON B. J., FERNANDES D., LAWSON A.M., MAH M., OPPENHEIMER J., ... REICH D. (2019): The genomic history of the Iberian Peninsula over the past 8000 years. Science 363(6432), 1230-1234. https://doi.org/10.1126/sci-ence.aav4040.
O'SULLIVAN N., POSTH C., COIA V., SCHUENEMANN V.J., PRICE T D., WAHL J., PINHASI R., ZINK A., KRAUSE J. & MAIXNER F. (2018): Ancient genome-wide analyses infer kinship structure in an Early Medieval Alemannic graveyard. Science advances 4(9), eaao1262. https://doi.org/10.1126/ sciadv.aao1262.
RAJKOVIC D. & VITEZOVIC S. (2020): The Starcevo culture horizon at the site of Knezevi Vinogradi (eastern Croatia): lithic and osseous industries. Documenta Praehistorica 47, 156-168.
REGUEIRO M., CADENAS A.M., GAYDEN T., UNDERHILL P.A. & HERRERA R.J. (2006): Iran: tri-continental nexus for Y-chromosome driven migration. Human heredity 61(3), 132-143. https://doi.org/10.1159/000093774.
REGUEIRO M., CADENAS A.M., GAYDEN T., UNDERHILL P.A. & HERRERA R.J. (2006): Iran: tri-continental nexus for Y-chromosome driven migration. Human heredity 61(3), 132-143. https://doi.org/10.1159/000093774.
RIVOLLAT M., JEONG C., SCHIFFELS S., KÛÇÛKKALIPÇI i., PEMONGE M.H., ROHRLACH A.B., ALT K.W., BINDER D., FRIEDERICH S., GHESQUIÈRE E., GRONENBORN D., LAPORTE L., LEFRANC P., MELLER H., RÉVEILLAS H., ROSENSTOCK E., ROTTIER S., SCARRE C., SOLER L., WAHL J., ... HAAK W. (2020): Ancient genome-wide DNA from France highlights the complexity of interactions between Mesolithic hunter-gatherers and Neolithic farmers. Science advances 6(22), eaaz5344. https://doi.org/10.1126/sciadv.aaz5344.
ROOTSI S., MYRES N.M., LIN A.A., JÄRVE M., KING R. J., KUTUEV I., CABRERA V.M., KHUSNUTDINOVA E.K., VARENDI K., SAHAKYAN H., BEHAR D.M., KHUSAINOVA R., BALANOVSKY O., BALANOVSKA E., RUDAN P., YEPISKOPOSYAN L., BAHMANIMEHR A., FARJADIAN S., KUSHNIAREVICH A., HERRERA R.J., ... UNDERHILL P.A. (2012): Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus. European journal of human genetics: EJHG 20(12), 1275-1282. https://doi.org/10.1038/ ejhg.2012.86.
SEMINO O., PASSARINO G., OEFNER P.J., LIN A.A., ARBUZOVA S., BECKMAN L.E., DE BENE-DICTIS G., FRANCALACCI P., KOUVATSI A., LIMBORSKA S., MARCIKIAE M., MIKA A., MIKA B., PRIMORAC D., SANTACHIARA-BENERECETTI AS., CAVALLI-SFORZA L.L. & UNDERHILL P.A. (2000a): The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y-chromosome perspective. Science 290(5494), 1155-1159. https://doi.org/10.1126/sci-ence.290.5494.1155.
SENGUPTA S., ZHIVOTOVSKY L.A., KING R., MEHDI S. Q., EDMONDS C.A., CHOW C.E., LIN A.A., MITRA M., SIL S.K., RAMESH A., USHA RANI M.V., THAKUR CM., CAVALLI-SFORZA L.L., MAJUMDER P.P. & UNDERHILL P.A. (2006): Polarity and temporality of high-resolution Y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists. American journal of human genetics 78(2), 202-221. https://doi.org/10.1086/499411.
SHAMSUDDIN MUHAMMAD IBN ABU TALIB AD-DIMASHKI (1300): Nuhbatu-d-dahr fi ajaibi-l-barr wa-l-bahr (Sampling of time about the curiosities of land and sea).
SKOURTANIOTI E., ERDAL Y. S., FRANGIPANE M., BALOSSI RESTELLI F., YENER K. A., PINNOCK F., MATTHIAE P., ÖZBAL R., SCHOOP U. D., GULIYEV F., AKHUNDOV T., LYONNET B., HAMMER E. L., NUGENT S. E., BURRI M., NEUMANN G. U., PENSKE S., INGMAN T., AKAR M., SHAFIQ R., . KRAUSE J. (2020): Genomic History of Neolithic to Bronze Age Anatolia, Northern Levant, and Southern Caucasus. Cell 181(5), 1158-1175.e28. https://doi.org/10.1016/j.cell.2020.04.044.
STOLAREK I., HANDSCHUH L., JURAS A., NOWACZEWSKA W., KOCKA-KRENZ H., MICHALOWSKI A., PIONTEK J., KOZLOWSKI P. & FIGLEROWICZ M. (2019): Goth migration induced changes in the matrilineal genetic structure of the central-east European population. Scientific reports 9(1), 6737. https://doi.org/10.1038/s41598-019-43183-w.
STROUS R.D., NOLAN K.A., LAPIDUS R., DIAZ L., SAITO T. & LACHMAN H.M. (2003): Aggressive behavior in schizophrenia is associated with the low enzyme activity COMT polymorphism: a replication study. American _ journal of medical genetics. Part B, Neuropsychiatric genetics: the official publication of the International Society of Psychiatric Genetics 120B(1), 29-34. https://doi.org/10.1002/ajmg.b.20021.
SZECSENYI-NAGY A., BRANDT G., HAAK W., KEERL V., JAKUCS J., MÖLLER-RIEKER S., KÖHLER K., MENDE B.G., OROSS K., MARTON T., OSZTÄS A., KISS V., FECHER M., PÄLFI G., MOLNÄR E., SEBÖK K., CZENE A., PALUCH T., SLAUS M., NOVAK M., . ALT K. W. (2015): Tracing the genetic origin of Europe's first farmers reveals insights into their social organization. Proceedings. Biological sciences 282(1805), 20150339. https://doi.org/10.1098/rspb.2015.0339.
TSUTSIEV A.A. (1999): Alans of Central Asia, I-VI centuries AD, Dissertation, Vladikavkaz, 200 pp. (In Russ.)
TUALLAGOV A.A. (2014): «Alan epigraphy»: some questions of historiography and the end of «polemics». Izvestiya SOIGSI 11 (50), 3-38. ISSN 2223-165X. (In Russ.)
TUALLAGOV A.A. (2015): Anthroponyms of the Zelenchuk inscription. Izvestiya SOIGSI 15 (54), 5-13. ISSN 2223-165X. (In Russ.)
TUALLAGOV A.A. (2015): Zelenchuk inscription. Vladikavkaz, 430 pp. ISBN 978-91480-232-2. (In Russ.)
TUALLAGOV A.A. (2016): About the circumstances of the discovery of the Zelenchuk inscription. Izvestia SOIGSI 20 (59), 5-14. ISSN 2223-165X. (In Russ.)
TUALLAGOV A.A. (2018): To the history of the discovery of the Zelenchuk inscription // From the history of culture of the peoples of the North Caucasus: a collection of scientific articles. Stavropol, 10, 90-101. ISBN 978-5-9500587-7-6. (In Russ.)
VAN DE LOOSDRECHT M.S., MANNINO M.A., TALAMO S., VILLALBA-MOUCO V., POSTH C., ARON F., BRANDT G., BURRI M., FREUND C., RADZEVICIUTE R., STAHL R., WISSGOTT A., KLAUSNITZER L., NAGEL S., MEYER M., TAGLIACOZZO A., PIPERNO M., TUSA S., COL-LINA C., SCHIMMENTI V., DI SALVO R., PRÜFER K., HUBLIN J.J., SCHIFFELS S., JEONG C., HAAK W. & KRAUSE J. (2020): Genomic and dietary transitions during the Mesolithic and Early Neolithic in Sicily. BioRxiv 2020.03.11.986158. https://doi.org/10.1101/2020.03.11.986158.
VANEK D., SASKOVA L. & KOCH H. (2009): Kinship and Y-chromosome analysis of 7th century human remains: novel DNA extraction and typing procedure for ancient material. Croatian medical journal, 50(3), 286-295. https://doi.org/10.3325/cmj.2009.50.286.
VEERAMAH K.R., ROTT A., GROß M., VAN DORP L., LÓPEZ S., KIRSANOW K., SELL C., BLÖCHER J., WEGMANN D., LINK V., HOFMANOVÁ Z., PETERS J., TRAUTMANN B., GAIR-HOS A., HABERSTROH J., PÄFFGEN B., HELLENTHAL G., HAAS-GEBHARD B., HARBECK M. & BURGER J. (2018): Population genomic analysis of elongated skulls reveals extensive female-biased immigration in Early Medieval Bavaria. Proceedings of the National Academy of Sciences of the United States of America 115(13), 3494-3499. https://doi.org/10.1073/pnas.1719880115.
VIDEIKO M. (2002): Trypillya Culture proto-cities: history of discovery and investigations, 103-125
VILLALBA-MOUCO V., VAN DE LOOSDRECHT M.S., POSTH C., MORA R., MARTÍNEZ-MORENO J., ROJO-GUERRA M., SALAZAR-GARCÍA D C., ROYO-GUILLÉN J.I., KUNST M., ROUGIER H., CREVECOEUR I., ARCUSA-MAGALLÓN H., TEJEDOR-RODRÍGUEZ C., GARCÍA-MARTÍNEZ DE LAGRÁN I., GARRIDO-PENA R., ALT K.W., JEONG C., SCHIFFELS S., UTRILLA P., KRAUSE J., ... HAAK W. (2019): Survival of Late Pleistocene Hunter-Gatherer Ancestry in the Iberian Peninsula. Current biology: CB, 29(7), 1169-1177.e7. https://doi.org/10.1016/ j.cub.2019.02.006.
WANG C.C., REINHOLD S., KALMYKOV A., WISSGOTT A., BRANDT G., JEONG C., CHERONET O., FERRY M., HARNEY E., KEATING D., MALLICK S., ROHLAND N., STEWARD-SON K., KANTOROVICH A.R., MASLOV V. E., PETRENKO V.G., ERLIKH V.R., ATABIEV B.C., MAGOMEDOV R.G., KOHL P.L., ... HAAK W. (2019): Ancient human genome-wide data from a 3000-year interval in the Caucasus corresponds with eco-geographic regions. Nature communications 10(1), 590. https://doi.org/10.1038/s41467-018-08220-8.
YARDUMIAN A., SHENGELIA R., CHITANAVA D., LALIASHVILI S., BITADZE L., LALIASH-VILI I., VILLANEA F., SANDERS A., AZZAM A., GRONER V., EDLESON K., VILAR M. G. & SCHURR T.G. (2017): Genetic diversity in Svaneti and its implications for the human settlement of the Highland Caucasus. American journal of physical anthropology 164(4), 837-852. https://doi.org/10.1002/ajpa.23324.
YCC (2002): A nomenclature system for the tree of human Y-chromosomal binary haplogroups. Genome research 12(2), 339-348. https://doi.org/10.1101/gr.217602.
YUNUSBAYEV B., METSPALU M., JÄRVE M., KUTUEV I., ROOTSI S., METSPALU E., BEHAR D.M., VARENDI K., SAHAKYAN H., KHUSAINOVA R., YEPISKOPOSYAN L., KHUSNUTDINOVA E.K., UNDERHILL P.A., KIVISILD T. & VILLEMS R. (2012): The Caucasus as an asymmetric semipermeable barrier to ancient human migrations. Molecular biology and evolution 29(1), 359-365. https://doi.org/10.1093/molbev/msr221.
