CC BY
30
Abdurakhimov Abrorjon Akramovich, researcher, Institute of Biophysics and Biochemistry at the National University of Uzbekistan, Center for Advanced Technologies of the Republic of Uzbekistan, Tashkent E-mail: Abror1978@mail.ru Dalimova Dilbar Akbarovna, doctor of philosophy (PhD)., Center for Advanced Technologies of the Republic of Uzbekistan, Tashkent E-mail. dalimova@gmail.com Turdikulova Shakhlo Utkurovna, doctor of biological science, Center for Advanced Technologies of the Republic of Uzbekistan, Tashkent E-mail: shahlo.ut@gmail.com
DETECTION OF HELICOBACTER PYLORI AND GENE CagA WITH USE REAL-TIME PCR IN THE UZBEKISTAN
Abstract: The CagA is one of the virulence factors of H.pylori, CagA is important in gastroduodenal disease pathogenesis and affect cure rates and almost 100% of the East Asian strains express CagA. All clinics installed real time PCR amplifiers, not the usual PCR. Therefore, we identificated gene CagA with help Real-Time PCR with sybr green. The detection of H.pylori UreC gene by Real- time PCR revealed that 100% of samples were positive. We found that the prevalence of CagA gene was 80% (68) and in addition, found gene CagA all local isolates 132, 142, 1740, 1741, 1742, 1743 H.pylori.
Keywords: H. pylori, CagA, UreC, peptic ulcer, duodenal ulcer, Real-Time PCR.
Introduction [11, 11221-11235; 12, 506]. The risk of gastrological disease
Helicobacter pylori, a spiral, Gram-negative, micro-aero- risk in a person infected with H.pylori includes: the virulence philic bacterium, colonizes at more half of the world's human of the infecting strain, human factors such as gene polymor-population and is recognized as a major cause of chronic phism and immunity [13, 713-739], environmental factors, gastritis, peptic ulcer, duodenal ulcers, gastric mucosa lym- such as diet, smoking [14, 372-380; 15, 5-10], alcohol [16, phoma (MALT lymphoma) and risk factor for gastric cancer 1381], high-Salt [17, 1-8]. Develop severe disease in the [1, 11654-11672; 2, 784-789]. H.pylori non-gastroentero- H.pylori virulence factors have been suggested to play impor-logical diseases; thrombotic purpura, chronic iron deficiency tant roles. H.pylori virulence factors strongly associated with anemia and vitamin B12 deficiency [3, 646-664; 4, 49-55; gastric and duodenal disease are the cytotoxin associated gene 5, 124-128; 6, 674-677; 7, 13434-13441]. In addition, the A (CagA), which is encoded by one of the genes located in effects of H.pylori on the immune system have been identi- the cag pathogenicity island (PAI). CagA protein, which is en-fied [8, 190]. Research by Sentos and other authors points coded by the CagA gene, is one of the most studied virulence out that H.pylori infection causes an epigenetic mechanism, factors of H.pylori. The presence of CagA in a strain results in that is, a disorder of gastric epithelial cells DNA and develop- an increased risk of gastric carcinogenesis compared with in-ment of congenital anomalies [9, 329-335]. In most cases the dividuals infected with CagA-negative strains [18, 764-777]. H.pylori infection is asymptomatic and but he is has been clas- About 60-70% of the western H.pylori strains and almost sified as a class I carcinogen in humans by a Working Group 100% of the East Asian strains express CagA [13, 713-739], of the World Health Organization International Agency for but the Central Asian strains are almost not been studied. Research on Cancer [10, 1-124]. H.pylori infection is preva- CagA is associated with epithelial tight junction, as a result lent worldwide with an estimated prevalence of 70-90% in destroys cellular junction, CagA leads to gastric epithelial cell developing countries and 30-40% in industrialized countries proliferation and carcinoma [13, 713-739; 19, 1003-1008].
Methods
2.1. Ethics statement
This study was approved by the Ethics Committee of the Republican Specialized Scientific and Practical Medical Center for Therapy and Medical Rehabilitation of the Ministry of Health of the Republic of Uzbekistan, Institute of Bio-organic chemistry of Uzbekistan Academy of Sciences and Republican Specialized Scientific Center named after Academician V. Vakhidov received a local and obtained all patients signed informed consent, in accordance with the Declaration.
2.2. Sample collection
Gastric biopsy samples were collected from 85 patients diagnosed with stomach ulcer and peptic ulcer at the Republican Specialized Scientific and Practical Medical Center for Therapy and Medical Rehabilitation ofthe Ministry ofHealth ofthe Republic ofUzbekistan between 2016 and 2017. Gastritis was investigated by endoscopy. 85 H.pylori infected gastritis patients including 52 men (44 ± 2.2 years) and 33 women (40 ± 1.6 years).
In addition, local isolates 132, 142, 1740, 1741, 1742, 1743 H. pylori were obtained from the Republican Specialized Scientific Center named after academician V Vakhidov [20, 222]. Biopsy were obtained from the stomach of each patient during endoscopy. DNA of H.pylori strain HP-26695 and DNA of venous blood samples (leukocytes) of humans were used as controls. H. pylori strain 26695 was used as a reference strain.
2.3. DNA Extraction
DNA samples were isolated from biopsy samples using the AmpliPrim RIBO-PREP reagent kit (interLabService, Russia) and Biospin Bacteria Genomic DNA Extraction Kit (Hangzhou Bioer Technology Co., Ltd. China) bacterial DNA in cultural H.pylori, according to the manufacturer's instructions. The concentration and purity of the isolated DNA samples were checked on a BioSpec-nano spectrophotometer (Shimadzu Biotech, Japan).
2.4. Detection of H. pylori and cagA gene by Real-Time PCR.
All PCRs were performed by real-time methods using the Step One Real-Time PCR system (Applied Biosystems, USA). The UreC gene (GlmM) to identify Helicobacter, and the CagA gene is the main virulence factor of H.pylori, and we chose the CagA and UreC genes, in addition, the main goal of our study was to use real-time PCR to detect the pathogenic CagA gene in biopsy specimens from patients with gastrointestinal diseases. The presence of H.pylori in the samples was confirmed by PCR using specific primers Forward 51- AAGCTTTTAGGGGTGTTAGGGGTTT -31, Revers 51- AAGCTTACTTTCTAACACTAACGC -31, and Probe FAM-CGATTGGGGATAAGTTTGTGAGCG-RTQ1 of the UreC (GlmM) gene [21, 1-6]. The following reagents were used for real-time PCR amplification of the H.pylori
CagA gene; final volume of 20 ^l containing primers Forward (20 pM) 5I-GATAACAGGCAAGCTTTTGAGG-3I and Revers (20 pM) 5I-CTGCAAAAGATTGTTTGGCA-GA-3I (Eurofins genomics, CustomArray. USA) [22, 22742279; 23, 3336-3338], 2 mkl 10 x PCR buffer + Sybr green (cat.№ R-402. Syntol, Russian), 2 mkl 2.5 mM MgCl2, 2 mkl 2.5 mM dNTP, 0.2 mkl Taq-polymerase (5u/^l) (Syntol, Russian), DNA 5 mkl (50 ng/mkl). For CagA gene evaluation, the PCR program contained 40 cycles of denaturation (95 °C for 4 min), annealing (58 °C for 30 s, extension at 72 °C for 45 s), and one final extension (72 °C for 3 min).
2.5. Data Analysis
Odds ratios and G-tests were used to evaluate the proportion of risk factors in the control and patient groups. The level of significance was set at 95%. Statistical analysis was performed using the Doctor Stat program. A p value less than 0.05 (p < 0.05) was accepted as statistically significant.
Results
Our study included 85 patients; they were suffering stomach ulcer and duodenal ulcer. All patients were examined en-doscopically and clinically. This study was designed to determine the frequency of H.pylori CagA gene in stomach from the Uzbekistan. The detection of H.pylori UreC (GlmM) gene by Real- time PCR revealed that 100% of samples were positive. We found that the prevalence of cagA gene was 80% (68) and in addition, found gene CagA all local 132, 142, 1740, 1741, 1742, 1743 H. pylori isolates. H.pylori-positive samples, cagA gene was detected. The cagA gene status has shown a significant relationship with gingival status stomach ulcer and duodenal ulcer (Fig. 1).
The presence of CagA gene was associated with a significantly higher frequency of stomach ulcer and duodenal ulcer (P = 0.001; P = 0.0009). Identification of the CagA H.pylori gene by the Real-Time PCR method reduced the time and increased the degree of sensitivity. All clinics installed real time PCR amplifiers, not the usual PCR.
All clinics installed real time PCR amplifiers, not the usual PCR. Therefore, we modified PCR in real time with the help of syber green. Real-time PCR system provides a highly sensitive assessment of CagA type as a new diagnostic tool for the pathogenicity of H.pylori infection.
Discussion. In this study, the detection of H.pylori and CagA gene was performed by Real-time PCR. Real-time PCR has a higher specificity than other metods. Using Real-Time PCR, Iraqi researchers discovered the CagA gene 75% with gastroduodenal diseases [24, 640-643]. Ruzsovics and others identified the s-region of the Cag and VacA genes using a sybr green probe [25, 369-377], but the difference between the s1, s2 types of the VacA s region cannot be differentiated using sybr green. CagA gene was associated with a significantly
higher frequency of gastritis. The CagA gene was found 81% in gastric and duodenal ulcer in the Iran [26, 1345-1349]. The definition of the H. pylori CagA gene using the real-time
PCR method is very rare in the literature and is characterized by high renaturation temperature and time taken for the reaction stage.
Figure 1. Representative amplification plots of real-time PCR targeting the CagA gene. Curves: 1-4, H.pylori DNA positive specimens; 26695- H.pylori strains DNA positive control, control (H.sapiens); broken line, threshold cycle line
In our studies, the reaction stages were modified and the time of the reaction was saved. Based on the results obtained in clinics, the Real-time PCR technique can be used to determine the virulent CagA H.pylori gene.
In perspective, we have planned to use the technology of multiplexed Real-time PCR using TaqMan probes, which will
reduce costs, increase degree sensitivity and save time analyzing the determination of the of virulence of H.pylori.
Conclusions. Frequency of gene CagA occurrence in patients with diseases of gastric ulcer and duodenal ulcer is not different. The CagA gene is associated in these incidence and it can be considered a marker gene.
References:
1. Sokic-Milutinovic A., Alempijevic T., Milosavljevic T. Role of Helicobacter pylori infection in gastric carcinogenesis: Current knowledge and future directions // World journal of gastroenterology. 2015.- V. 21.- No. 41.- P. 11654-11672.
2. Uemura N., Okamoto S., Yamamoto S., Matsumura N., Yamaguchi S., Yamakido M., Taniyama K., Sasaki N., Schlemper, R. J. Helicobacter pylori infection and the development of gastric cancer // New England Journal of Medicine. 2001.-V. 345.- No. 11.- P. 784-789.
3. Malfertheiner P., Megraud F., O'morain C. A., Atherton J., Axon A. T., Bazzoli F., El-Omar E. M. Management of Helicobacter pylori infection-the Maastricht IV / Florence consensus report // Gut. 2012.- V 61.- No. 5.- P. 646-664.
4. Banic M., Franceschi F., Babic Z., Gasbarrini A. Extragastric manifestations of Helicobacter pylori infection // Helicobacter. 2012.- V. 17.- No. 1.- P. 49-55.
5. Chen B. F., Xu X., Deng Y., Ma S. C., Tang L. Q., Zhang S. B., Chen Z. F. Relationship between Helicobacter pylori infection and serum interleukin-18 in patients with carotid atherosclerosis // Helicobacter. 2013.- V. 18.- No. 2.- P. 124-128.
6. Villanacci V., Casella G., Lanzarotto F., Di Bella C., Sidoni A., Cadei M., Salviato T., Dore M. P., Bassotti G. Autoimmune gastritis: relationships with anemia and Helicobacter pylori status // Scandinavian journal of gastroenterology. 2017.-V. 52.- No. 6-7.- P. 674-677.
7. Xu M. Y., Cao B., Yuan B. S., Yin J., Liu L., Lu Q. B. Association of anaemia with Helicobacter pylori infection: a retrospective study // Scientific reports. 2017.- V. 7.- No. 1.- P. 13434-13441.
8. Utsch C., Haas R. VacA's induction ofVacA-containing vacuoles (VCVs) and their immunomodulatory activities on human T cells // Toxins. 2016.- V. 8.- No. 6.- 190 p.
9. Santos J. C. Gambeloni R. Z., Roque A. T., Oeck S., Ribeiro M. L. Epigenetic Mechanisms ofATM Activation after Helicobacter pylori Infection // The American journal of pathology. 2018.- V. 188.- No. 2.- P. 329-335.
10. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans, International Agency for Research on Cancer, and World Health Organization. Schistosomes, Liver Flukes and Helicobacter Pylori: IARC Monographs on the Carcinogenic Risks to Humans. World Health Organization. 1994.- P. 1-124.
11. Wang Y. K., Kuo F. C., Liu C. J., Wu M. C., Shih H. Y., Wang S. S., Wu J. Y., Kuo Ch.H., Huang Y. K., Wu D. C. Diagnosis of Helicobacter pylori infection: Current options and developments // World Journal of Gastroenterology: WJG. 2015.-V. 21.- No. 40.- P. 11221-11235.
12. Kountouras J., Zavos C., Polyzos S. A., Deretzi G. The gut-brain axis: interactions between Helicobacter pylori and enteric and central nervous systems // Ann Gastroenterol. 2015.- No. 28.- 506 p.
13. Wroblewski L. E., Peek R. M., Wilson K. T. Helicobacter pylori and gastric cancer: factors that modulate disease risk // Clinical microbiology reviews. 2010.- V. 23.- No. 4.- P. 713-739.
14. Li L. F., Chan R. L., Lu L., Shen J., Zhang L., Wu W. K., Wang L., Hu T., Li M. X., Cho C. H. Cigarette smoking and gastrointestinal diseases: the causal relationship and underlying molecular mechanisms // International journal of molecular medicine.2014.-V. 34.-No. 2.- P. 372-380.
15. Chu K. M., Cho C. H., Shin Y. V. Nicotine and gastrointestinal disorders: its role in ulceration and cancer development // Current pharmaceutical design. 2013.- V. 19.- No. 1.- P. 5-10.
16. Ma S. H., Jung W., Weiderpass E., Jang J., Hwang Y., Ahn C., Ko K. P., Chang S. H., Shin H. R., Yoo K. Y., Park S. K. Impact of alcohol drinking on gastric cancer development according to Helicobacter pylori infection status // British journal of cancer. 2015.- V. 113.- No. 9.- 1381 p.
17. Li J., Sun F., Guo Y., Fan H. High-Salt Diet Gets Involved in Gastrointestinal Diseases through the Reshaping of Gastroenterological Milieu // Digestion. 2018.- P. 1-8.
18. Tsugawa H., Suzuki H., Saya H., Hatakeyama M., Hirayama T., Hirata K., Nagano O., MatsuzakiJ., Hibi T. Reactive oxygen species-induced autophagic degradation of Helicobacter pylori CagA is specifically suppressed in cancer stem-like cells // Cell host & microbe. 2012.- V. 12.- No. 6.- P. 764-777.
19. Ohnishi N., Yuasa H., Tanaka S., Sawa H., Miura M., Matsui A., Higashi H., Musashi M., Iwabuchi K., Suzuki M., Yamada G. Transgenic expression of Helicobacter pylori CagA induces gastrointestinal and hematopoietic neoplasms in mouse // Proceedings of the National Academy of Sciences. 2008.- V. 105.- V. 3.- No. 3.- P. 1003-1008.
20. Баженов Л. Г. Helicobacter pylori при гастродуоденальной патологии: выделение, микроэкология и чувствительность к антимикробным факторам: Диссертация доктора медицинских наук // Дисс. д-ра мед. наук. 1998.- 222 c.
21. Rune Johannessen, ^re Bergh, Constantin Jianu, Per Martin Kleveland. Polymerase chain reaction versus culture in the diagnosis of Helicobacter pylori infection // Gastroenterology Insights. 2013.-V. 5.- No. 1.- P. 1-6.
22. Yamaoka Y., Kodama T., Gutierrez O., Kim J. G., Kashima K., Graham D. Y. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries // Journal of clinical microbiology. 1999.- V. 37.- No. 7.- P. 2274-2279.
23. Park C. Y., Kwak M., Gutierrez O., Graham D. Y., Yamaoka Y. Comparison of genotyping Helicobacter pylori directly from biopsy specimens and genotyping from bacterial cultures // Journal of clinical microbiology. 2003.- V. 41.- No. 7.-P. 3336-3338.
24. Jabbar H. S., Adulsamed A. Gene detection of Helicobacter-pylori by use real-time PCR in patients from Wasit province: Iraq // Journal of Entomology and Zoology Studies. 2018. Т.- 6.- No. 2.- P. 640-643.
25. Ruzsovics A., Molnar B., Unger Z., Tulassay Z., Pronai L. Determination of Helicobacter pylori cagA, vacA genotypes with real-time PCR melting curve analysis // Journal of Physiology-Paris. 2001.- V. 95.- No. 1-6. - P. 369-377.
26. Dadashzadeh K., Milani M., Somi M. H. The prevalence of Helicobacter pylori cagA and iceA genotypes and possible clinical outcomes // Acta Medica Mediterranea. 2015.- No. 31.- P. 1345-1349.
