CC BY
7
CRISPR/Cas9 Essential Gene Editing in Drosophila
I. S. Osadchiy, S. O. Kamalyan, K. Y. Tumashova, P. G. Georgiev, O. G. Maksimenko* Institute of Gene Biology, Russian Academy of Sciences, Moscow, 119334 Russian Federation *E-mail: [email protected]
Received: December 08, 2022; in final form, April 04, 2023 DOI: 10.32607/actanaturae.11874
Copyright © 2023 National Research University Higher School of Economics. This is an open access article distributed under the Creative Commons Attribution License,which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ABSTRACT Since the addition of the CRISPR/Cas9 technology to the genetic engineering toolbox, the problems of low efficiency and off-target effects hamper its widespread use in all fields of life sciences. Furthermore, essential gene knockout usually results in failure and it is often not obvious whether the gene of interest is an essential one. Here, we report on a new strategy to improve the CRISPR/Cas9 genome editing, which is based on the idea that editing efficiency is tightly linked to how essential the gene to be modified is. The more essential the gene, the less the efficiency of the editing and the larger the number of off-targets, due to the survivorship bias. Considering this, we generated deletions of three essential genes in Drosophila: trf2, top2, and mep-1, using fly strains with previous target gene overexpression ("pre-rescued" genetic background).
KEYWORDS CRISPR/Cas9, genome editing, essential gene editing, housekeeping genes.
ABBREVIATIONS gRNA - guide RNA; chr - chromosome; kb - kilobase; TRF2 - TBP-related factor 2; Top2 -type II topoisomerase; MEP-1 - MOG interacting and ectopic P-granules protein 1.
INTRODUCTION
Recent advances in the use of CRISPR/Cas9 as a programmable tool for the introduction of DNA double-strand breaks significantly expanded possibilities in deciphering the functions of genes and genomic regulatory elements. The CRISPR/Cas9 system is the most suitable for knocking out a gene of interest (GOI) by generating shifts in the reading frame of the target gene. However, if the GOI is an essential one, attempts to generate a knock-out can be ineffective due to lethality in successfully edited embryos, biological plasticity that rescues the induced frameshift or deletion by translation reinitiation, defective exon skipping, etc. [1]. Here, we report on a case of CRISPR/Cas9 use, in combination with target gene overexpression, that allowed us to quite effectively knock out three essential genes in Drosophila. A similar approach has recently been validated in human HEK293T cells [2]. By using this approach, we deleted a relatively long region of the GOI coding sequence and replaced it with a landing platform, which allows for fast and effective insertion of modified gene constructs.
EXPERIMENTAL
The strategy presented here is an addition to the methods described in [3-5] and suitable for ubiquitously expressed essential genes. Our method consists of three steps (Fig. 1):
1. Insertion of the GOI copy (lacking CRISPR/Cas9 target sequences) and reporter gene 1 into a "safe harbor" knock-in site located on a different chromosome. This step results in the generation of the rescue line with homologous expression of the GOI copy. For this, we have created rescue constructs carrying protein-coding sequences of either TRF2, Top2, or MEP-1 under the control of the Ubi-p63E promoter and the yellow gene as reporter 1. Previously obtained knockouts of these genes were embryonic lethal. The constructs were inserted into either 86Fb (TRF2/Top2) or 38D (MEP-1) chromosomal loci via ^C31-mediated site-specific integration.
2. Replacement of the GOI with the attP site by injection of three plasmids: carrying Cas9 and gRNAs for extensive deletion of the GOI protein-coding sequence and a template plasmid for homology-directed repair (HDR) containing the attP site for the ^C31 integrase and reporter gene 2 (mCherry), flanked by loxP sites. This step results in the generation of the GOI knockout line with a GOI copy overexpression background.
In this work, the following CRISPR/Cas9 Drosophila strains obtained from The Bloomington Drosophila Stock Center at Indiana University were used: BL54591 (Cas9 under the control of the nanos promoter) and BL58492 (Cas9 under the control of the Actin5C promoter). Alternatively, the Addgene
A
Gene_______
of interest (GOI)
C
GOI
HR
GOI overexpression Nucleus
i h m
Plasmid injection
GOI copy without targets for Cas9 + reporter gene 1
gRNA
'pre-rescued" embryo CRISPR/Cas9 + homologous recombination (HR)
Cas9
T
Cas9
T
UTR
intron
Chr I
>
HR
I
loxP reporter 2 loxP attP Plasmid template for GOI
Chr II
reporter 1 GOI copy without targets for Cas9
D
Edited GOI -L^-
loxP reporter 3 loxP construct
with modified conspue*
attP-attB and CRE-loxP recombination
Chr I
attB
loxP
tag attL
wild type
Chr II
B
Fig. 1. The strategy for essential gene replacement. (A) Insertion of a gene copy lacking targets for Cas9 and reporter gene 1 (yellow) into a "safe harbor" knock-in site on a different chromosome via site-specific recombinase-mediated integration (SSRMI). (6) Microinjection of an HDR template and plasmids expressing Cas9 and gRNAs into "pre-rescued" embryos. (C) CRISPR/Cas9-mediated DNA double-strand breaks and homologous recombination (HR) with the plasmid template carrying loxP-flanked reporter gene 2 (mCherry) and an attP site. (D) The result of subsequent SSRMI of the modified gene of interest (GOI) sequence followed by CRE-mediated reporter gene 2 (mCherry) and 3 (white) excision and removal of the GOI copy
#62209 helper plasmid was added to the injection mixture as a source of Cas9. CRISPR targets were designed using the Optimal Target Finder software (University of Wisconsin) [4] and cloned into the vector based on pCFD4-U6:1_U6:3tandemgRNAs (Addgene #49411). The following gRNAs were used for trf2 deletion: gRNA1 (tcttcgtgcatactcttagc), gRNA2 (tgcttttcgcttcggtgtcc), and gRNA3 (accaag-tagctagagactta); the gRNA1/gRNA2 pair leads to deletion of a 6.7 kb genomic fragment; gRNA1/gRNA3 causes deletion of a 1.1 kb fragment. For mep-1, the
following gRNAs were used: gRNA1m (acgaacag-cagggcgcgcgc), gRNA2m (cagcaagtgacgctggcttg), and gRNA3m (aggggatcttcggcctcgca). They produce 5.6 (gRNA1m/ gRNA2m) and 2 kb (gRNA1m/ gRNA3m) deletions. For top2 deletion, gRNA1t (gttcccagtacag-tagcacc) and gRNA2t (tctacggcgtgttcccgctt) producing a 2 kb deletion were used.
The flies obtained after injection (F0) were individually mated with y1w1118 flies; potential genome editing events in the progeny (F1) were detected by mCherry fluorescence. The insertion of the landing
platform (attP-mCherry) into the genome was confirmed by PCR with primers annealing outside the homology regions used for HDR.
3. Insertion of a modified GOI variant labelled with loxP-flanked reporter gene 3 (white gene) via site-specific recombination. Flies were injected with a mixture containing two plasmids: a plasmid with a modified gene variant and the attB site, and the ^C31 integrase helper plasmid (Addgene #26290). After integration of the modified variant, reporter genes 2 and 3 were removed by crossing with a Cre recombi-nase-expressing line.
RESULTS AND DISCUSSION
The TRF2 protein is a paralog of the basal transcription factor TBP; its inactivation is associated with embryonic lethality [6, 7].
Previously, we failed to replace the trf2 gene with a landing platform for site-specific integration of modified gene variants despite the use of two different Cas9 sources (Cas9-expressing fly lines and the Cas9-expressing plasmid injected into embryos) and two gRNA combinations [8]. The whole trf2 gene spans approximately 25 kb, while its protein-coding region is roughly 7 kb. The chosen gRNA combinations produced two DNA double-strand breaks at distances of 6.7 and 1.1 kb for deletion and concomitant replacement by the landing platform of the whole protein-coding region or only the start codon-containing region, respectively (Fig. 2A).
The results obtained for the different editing schemes used for trf2 gene replacement are summarized in Table 1.
The F0 embryos without background trf2 overexpression were characterized by a low survival rate. In the developing larvae, mCherry reporter fluorescence was observed in tissues in the vicinity of the injection site and throughout the whole embryo. The larvae with the most spread and intense fluorescence died later during development. As a result of mating the surviving F0 flies with the wild-type line, only one fly line with insertion of the landing platform into the intron corresponding to the 5" double-strand break without the deletion of the trf2 coding region was obtained.
In order to overcome the high lethality rate due to trf2 deletion, we generated a fly line with trf2 overexpression by site-specific integration of the trf2 short isoform using a line with the attP at locus 86Fb.
The trf2-overexpressing embryos injected with the gene editing mix had normal viability. As a result, we obtained five fly lines with insertion of the mCherry reporter gene for each of the gRNA combinations, producing 6.6 and 1.1 kb deletions, respectively.
A
trf2
Cas9
Y
Cas9
y
6.7 kbp
Chr I
HR
HR
500
HDR template
700
trf2
Cas9 Cas9
Y Y
Chr I
HR 1.1 kbp
HR
500 500
HDR template
Cas9
V 1
mep-1
Cas9
V
Chr III
HR
5.6 kbp
HR
900
HDR template
800
Cas9 Cas9
Y Y
mep-1
2.0 kbp
Chr III
HR
900
HDR template
HR 700
C
top2
Cas9
Y
Cas9
Y
2,053 bp
Chr II
HR
HR
520 HDR template 576
Fig. 2. CRISPR/Cas9- and HDR-mediated gene replacement with the attP site and reporter gene mCherry. The genes trf2 (A), mep-1 (B), and top2 (C) and homologous recombination templates for either full-length or partial deletions are presented
We additionally validated this approach on other genes: mep-1 and top2.
MEP-1 is a protein that facilitates the recruitment of the nucleosome remodeling and histone deacety-lation (dNuRD) complex to many gene promoters [9, 10]. It is an important regulator of early development
B
Table 1. Results of plasmid microinjections for the replacement of the trf2, mep-1, and top2 genomic regions with a landing platform
Fly line Cas9 source Deletion, bp Embryos injected Flies eclosed, F0 mCherry+ F1 lines Off-targets
y!w1118 Cas9-expressing plasmid 6700 200 100 - -
CKl ^ 54591 Cas9 under nanos promoter 6700 250 140 1 +
PS EH 58492 Cas9 under Actin5C 6700 200 80 - -
promoter 1100 250 120 - -
y1W1118 + Cas9-expressing 6700 100 80 5 2
TRF2 overexpression plasmid 1100 100 80 5 2
P^ y1W1118 Cas9-expressing 2000 5600 300 150 160 90 1 -
H § y1W1118 + MEP-1 overexpression plasmid 5600 240 175 4 -
CKl PL, y1W1118 Cas9-expressing 2053 150 100 - -
o EH y1W1118 + Top2 overexpression plasmid 2053 150 80 3 -
in Drosophila; mep-1 gene inactivation leads to embryonic lethality.
As in the case of trf2, the selected gRNA combinations resulted in two DNA double-strand breaks spaced 5.6 or 2 kb apart for the full-length and start codon region deletions, respectively (Fig. 2B). The results obtained for the different editing schemes used for mep-1 gene replacement are summarized in Table 1.
Embryos injected with the mixture for mep-1 gene replacement without mep-1 overexpression background had moderate lethality during development. Mating of F0 flies resulted in only one fly line, which had a long gene deletion. Meanwhile, injection of the embryos with background mep-1 overexpression led to the generation of four fly lines with the landing platform. Thus, mep-1 deletion is not completely lethal; however, its overexpression increases the viability of injected embryos and, as a consequence, gene editing effectiveness.
Topoisomerase 2 (Top2) is an enzyme that releases topological tension in the DNA molecule; it contributes to genome stability and participates in key cell processes such as replication, transcription, and recombination [11].
For the replacement of the top2 gene with the landing platform, we designed a pair of gRNAs targeting Cas9 to the loci 2 kb apart from each other located in 5"UTR and exon 3 of top2. The editing plas-mid mixture for gene replacement was injected into y1w1118 fly embryos. There were no cases of platform
insertion in the progeny of individual matings of F0 with wild type flies. However, editing upon insertion of the Top2 coding sequence in the 86Fb chromosomal locus resulted in three knockout fly lines (Table 1).
The use of Cas9 for genome editing is frequently accompanied by additional unspecified mutations throughout the genome. Since mutations usually manifest themselves through phenotype and/or a change in the survival rate, GOI overexpression on a different chromosome allows one to probe the mutations on the GOI chromosome in a line homozygous for GOI deletion. Therefore, it is possible to select only lines without severe mutations.
The generated fly lines homozygous for Atrf2, Amep-1, or Atop2 deletion were lethal without the additional rescuing copy. This corroborated the essentiality of the edited genes and provided initial evidence of successful gene replacement with the attP-plat-form. Site-specific integration of a restoring construct (coding for the wild-type gene variant) into the corresponding landing platform line and subsequent removal of the reporter genes led to the recovery of gene function and normal viability of homozygous flies lacking the rescuing copy. Thus, overexpression induced prior to gene editing allowed us to obtain landing platforms for a detailed study of three Drosophila proteins: TRF2, Top2, and Mep-1.
This work was supported by the Russian Science Foundation (grant No. 19-74-30026).
REFERENCES
1. Smits A.H., Ziebell F., Joberty G., Zinn N., Mueller W.F., Clauder-Münster S., Eberhard D., Fälth Savitski M., Grandi P., Jakob P., et al. // Nat. Methods. 2019. V. 16.
№ 11. P. 1087-1093.
2. Wang B., Wang Z., Wang D., Zhang B., Ong S.G., Li M., Yu W., Wang Y. // J. Biol. Eng. BioMed Central. 2019. V. 13. № 1. P. 35.
3. Gratz S.J., Ukken F.P., Rubinstein C.D., Thiede G., Dono-hue L.K., Cummings A.M., O'Connor-Giles K.M. // Genetics. 2014. V. 196. № 4. P. 961-971.
4. Zolotarev N., Georgiev P., Maksimenko O. // Biotechniques. Future Science. 2019. V. 66. № 4. P. 198-201.
5. Bischof J., Maeda R.K., Hediger M., Karch F., Basler K. // Proc. Natl. Acad. Sci. USA. 2007. V. 104. № 9. P. 3312-3317.
6. Kedmi A., Zehavi Y., Glick Y., Orenstein Y., Ideses D., Wachtel C., Doniger T., Waldman Ben-Asher H., Muster
N., Thompson J., et al. // Genes Dev. 2014. V. 28. № 19. P. 2163-2174.
7. Duttke S.H.C. // Trends Biochem. Sci. 2015. V. 40. № 3. P. 127-129.
8. Osadchiy I.S., Georgiev P.G., Maksimenko O.G. // Dokl. Biochem. Biophys. 2019. V. 486. № 1. P. 224-228.
9. Reddy B.A., Bajpe P.K., Bassett A., Moshkin Y.M., Kozhevnikova E., Bezstarosti K., Demmers J.A., Travers A.A., Verrijzer C.P. // Mol. Cell. Biol. Am. Soc. Microbiol. 2010. V. 30. № 21. P. 5234-5244.
10. Kunert N., Wagner E., Murawska M., Klinker H., Kremmer E., Brehm A. // EMBO J. 2009. V. 28. № 5. P. 533-544.
11. Sutormin D.A., Galivondzhyan A.K., Polkhovskiy A.V., Kamalyan S.O., Severinov K.V., Dubiley S.A. // Acta Naturae. 2021. V. 13. № 1. P. 59-75.
