CC BY
473
Yong Huangb*, Quan Zouc, Xing Jia Shenb, Xue Li Yu a, Zhan Bin Wanga, Xiang Chao Cheng a
CONSTRUCTION OF BACULOVIRUS EXPRESSION VECTOR OF miRNAs AND ITS EXPRESSION IN INSECT CELLS
a Animal Science and Technology College, He Nan University of Science and Technology, Luoyang City,471003, Henan Province,
PR China.
b The Key Laboratory of Silkworm and Mulberry genetic Improvement, Ministry of Agriculture, Sericultural Research Institute, Chinese Academy of Agricultural Sciences, Zhenjiang City, 212018, Jiangsu Province, PR China. c School of information Science and Technology of Xiamen University, Xiamen city, 361005, Fujian Province, PR China.
MicroRNAs (miRNAs) are endogenous small non-protein coding RNAs that play important regulatory roles in animals and plants by binding to target transcripts for cleavage or translational repression. The miR-9a is very conservative in animals from flies to humans. Studies indicated that miR-9a is involved in the regulation of neurogenesis in animals. In our study, the baculovirus expression system was used to transcribe a recombinant vector containing miR-9a for further analysis the function of miR-9a. The sequence of pre-miR-9a from silkworm DNA was first cloned into the donor pFastBac. The enhanced green fluorescent protein (EGFP) was used as reporter gene. The recombinant donor plasmid pFastBac-miR-9a was transformed into E.coli DH10Bac /AcNPV forming Bacmid-9a which was trans-fected into insect cells with cational lipofectin. The transcription of mature miR-9a was detected by Real-time PCR. The results show the recombinant Bacmid-9a was successfully constructed and effectively transcribed miR-9a in infected Sf21 insect cells.
Key words: Baculovirus expression system; MiR-9a; AcNPV; Sf21 cells
A novel post-transcriptional silencing process was discovered at the turn of the century. It is elicited by tiny endogenous RNAs called microRNAs (miRNAs). MiRNAs are a class of small, non-coding regulatory RNAs that are important in post-transcriptional gene silencing [2, 15]. They regulate gene expression by binding to 3' untranslated region (UTR) of their target mRNAs for cleavage or translational repression. MiRNAs have recently attracted widespread attention due to their critical roles in a wide spectrum of biological processes in multi-cellular eukaryotes. Recent studies have shown that many miR-NAs are involved in many biological processes, such as transcriptional gene regulatory network, developmental timing, neuronal synapses formation, cell proliferation, cell death, viral infection, differentiation and tumor metastasis [18, 19, 23].
Previous research indicated that lentiviruses, adeno-virus and retroviral expression system have been used to express miRNAs successfully [34, 39, 42]. The baculo-virus expression system is also one of the most powerful and versatile eukaryotic expression systems available. It has been a popular tool for expressing foreign genes, which utilizes the recombinant virus carrying the gene of interest to infect cultured cells or host larvae [11, 37, 41], because it is safer and has higher expression level compared to mammalian systems. Currently, totally 487 miRNAs have been identified from silkworm on the miRBase database (http://www.mirbase.org/). However, little is known about the function of miRNAs in the silkworm. We constructed the first recombinant baculovirus, bacmid-miR-9a, expressing the silkworm miR-9a using
a baculovirus expression system based on Autographa californica nuclear polyhedrosis virus (AcNPV). A large quantity of the mature miR-9a was expressed in Sf21 cells after infection with bacmid-miR-9a which was detected by real-time PCR. Our studies show that the recombinant baculovirus vector carrying silkworm miR-9a was successfully constructed, which lay a foundation for further miR-9a function research in vitro or in silkworm.
Materials and methods
Materials and reagents. The E. coli DH10Bac/AcN-PV was constructed and supplied by the Institute of Biochemistry and Cell Biology, Chinese Academy of Science. Plasmid pFasBacl and Sf21 insect cells were purchased from Invitrogen. Plasmid pEGFP-N3 (Clontech) was preserved in our laboratory. Restriction enzyme and T4 DNA ligase were obtained from Takara; primer and other reagents were obtained from Sangon Biotech. Sf21 Grace's insect cell culture medium was obtained form In-vitroge.
Construction of recombinant donor plasmid pFast-Bac-miR-9a. The 290 bp fragment of flanked sequences of pre-miR-9 was amplified using silkworm genomic DNA as template. The forward primer was 5'- CTGCA-GAATTGAATAGAAAAAAAATATAACTATATC-3' (Pst I), and the reverse primer was 5'- GGTACCGACA-GATATAGGGAAAGAGAA -3' (Kpn I). PCR was done under the following conditions: incubation at 940 for 5 min, 35 cycles incubation at 940 for 1 min, 550 for 1 min, 720 for 2 min, and final incubation at 720 for 10 min. The PCR products were inserted into the cut pFastBac donor plasmid using the same restriction site. The resultant recombinant plasmid was designated pFastBac-miR-9a and identified by sequencing performed by a commercial service provider (Sangon Biotech). Finally, EGFP fragment which was used as reporter gene from pEGFP-N3 plasmids was digested and then ligated to Sal I and Sac I restriction sites of pFastBac-miR-9a. The forward primer was 5'-GTCGACGCGTGAGCAAGGGCGAGGA -3' (Sal I), and the reverse primer was 5'-GAGCTC TTACT-TGTACAGCTCGTCCATGC-3' (Sac I).
Generation of recombinant bacmid. The donor plasmid pFastBac containing miR-9a gene fragment was transformed to E.coli DH10Bac/AcNPV. The E.coli DH10Bac containing recombinant bacmid baculoviruses was propagated on LB medium containing antibiotics (50 ^g/ml kanamycin, 7 ^g/ml gentamicin, and 10 ^g/ ml tetracycline), 100 ^g/ml X-gal and the inducer, 40 ^g/ ml IPTG. The white colonies resistant to three antibiotics were selected for further amplification. The recombinant bacmid-miR-9a was then extracted according to the pro-
* Corresponding author. Fax: +86 379 64282333 E-mail address: [email protected]
МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ №2, 2012
Table 1
Sequences of RT primers, forward primers and reverse primers.
Gene Name Primer Sequence
miR-9a RT 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCATAC-3'
Forward 5'- GCGGCTCTTTGGTTATCTAG-3'
Reverse 5' -TCCCGACCACCACAGCC-3'
U6 RT 5'- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACGATT-3'
Forward 5'- CCTGCGCAAGGATGAC-3'
Reverse 5' -TCCCGACCACCACAGCC-3'
tocol and analyzed to verify successful gene transposition to the bacmid by PCR with the M13 primers.
Cell culture and Transfections. The Sf21cells were seeded into 12 cm2 flasks at a density of about 5*105 cells/mL and cultured for 72 h. Before transfection, the medium was removed and the cells were washed three times by serum-free Grace's medium. The cells were transfected with 100 ^L transfection solution containing 5 ^L Lipofectamine 2000 and 1 ^g recombinant plasmid in 1 mL serum-free medium for 4-6 h. Then the serum-free medium was replaced by Grace's medium supplemented with 10% fetal bovine serum, penicillin (200 ^g /ml) and streptomycin (100 ^g/ml) at 270 with 5% CO2.
Real-time PCR detection
The expression of miR-9a was detected by real-time PCR at 72h after infection. Total small RNA was isolated from Sf21 cells using mirVana™ miRNA Isolation Kit (Ambion) according to manufacturer's instruction. cDNA was synthesized form a total of 500 ng of RNA in a 20 ^l reaction system by using specific stem-loop primes for miRNA [5, 6]. The cDNAs were diluted 10 times. Realtime PCR were performed in 20 ^l mixture containing 1 ^l cDNA, 800 nM forward and reverse primers, 10 ^l of the 2*SYBR green PCR master mix (Takara). Realtime PCR primers used in this experiment are indicated
in Table 1. The reaction was performed in triplicate on an opticon lightcycler ("Bio-Rad Laboratories").The reactions were amplified for 15 s at 950 and 30 s at 570 for 40 cycles. Expression data were normalized by the levels of 5S rRNA. Data were presented as the mean value ± SD from three separate experiments. The p-values lower than 0.05 were considered as significant.
Results and discussion Identification of pFastBac-miR-9a. Pre-miRNA was amplified by silkworm DNA as a template and the PCR products were detected by electrophoresis with 1% agarose gel containing ethidium and photographed under UV light. The 290bp fragment was amplified (Figure 1). The pre-miRNA fragment could be isolated from the pFastBac-miR-9a vector after the recombinant plasmid was digested with Pst I and Kpn I (Figure 2). These results showed that the pFastBac-miR-9a vector was successfully constructed.
Identification of recombinant bacmid-miR-9a Recombinant bacmid DNA is greater than 128 kb in size, so restriction analysis is difficult to perform with DNA. PCR analysis was used to identify recombinant bacmid. The bacmid contains M13 forward and reverse priming sites flanking the mini-attTn7 site, facilitating
Figure 1. The fragment of pre-miR-9a was amplified from silkworm genomic DNA M: DL2000 maker; 1A PCR products
Figure 2. Indentification of pFastBac-miR-9a by double restriction digestion
M: DNA maker; 1: pFastBac-miR-9a digested by PstI and Kpnl
Figure 3. Identification of the recombinant donor vector Bacmid-miR-9a by PCR with M13 forward and M13 reverse primer.
M@DNA maker, 1: Bacmid-miR-9a; 2: non-recombinant bacmid
PCR analysis. The PCR amplification products from recombinant bacmid-miR-9a generated a band of □ □3350bp (lane 1 in Figure 3), which was theoretically concordant with ^2300bp plus target miR-9a (290 bp) gene and EGFP (760bp), while amplification of the non-transposed bacmid (non-recombinant bacmid) generated a ^00 bp band (lane 2 in Figure 3), thus indicating the successful construction of recombinant Bacmid-miR-9a. The strategy for construction recombinant Bacmid-miR-9a is illustrated in figure 4.
Real-time PCR assay. After 72 h post-infection, Sf21 cells infected with recombinant Bacmid-miR-9a showed signs of infection and were examined by fluorescent microscope. Fluorescent signal was detected in cells (Figure 5). To accurately assess whether miR-9a is expressed by the recombinant bacmid-miR-9a, sf21 cells were collected and total RNA was extracted. Real-time
PCR results shows non-infected and non-recombinant bacmid Sf21 cells have the lowest expression, while the sf21 cells infected with recombinant Bacmid-miR-9a has a high level of miR-9a expression (Figure 6). The result suggested that RNA transcript of the recombinant virus of Bacmid-miR-9a in infected Sf 21 cells produced precursor miRNA and processed into mature miR-9a by Dicer. Our method of construction showed that the recombinant bacmid-miR-9a can transcrib mature miR-9a gene effectively in Sf21 cells.
The very first miRNAs lin-4 and let-7 were identified in C.elegans, which control developmental timing, by regulating translation of their respective targets [20, 28]. These discoveries indicated that this class of non coding RNA molecules may constitute a new layer of regulatory control over gene expression programs. Since then, more and more studies were focused on miRNAs field. The studies found that miRNAs are widely present in multicellular organisms, ranging from plants to humans and virus [10, 16, 25]. Accumulating evidence indicates that miRNAs play a central role in controlling a broad range of biological activities including embryonic development, cell proliferation, metabolic homeostasis and apoptosis [26, 31, 36]. In addition, deregulation of miRNA expression was associated with different type and stage of cancer [30]. The high conservation of miRNA is closely related to physiological functions [40]. Previous studies showed that miR-9a functions to fine-tune senseless (sens) expression and the proneural gene feedback loop, thereby ensuring the precision of the production of sensory organ precursors (SOPs) in Drosophila [3, 21]. Subsequent study also confirmed that miR-9a ensures the generation of the precise number of neuronal precursor cells during development [4]. Intriguingly, miR-9a is 100% conserved from flies to humans, and miR-9a is highly expressed in neurogenic regions in the developing and adult animal brain [9]. S.Liu et al. studies found that miR-9a was highly expressed in the silkworm embryos implying miR-9a may play an important functional role during embryogenesis [22]. But so far, the functional
Figure 4. Schematic diagram of the construction of the recombinant AcNPV Bacmid-miR-9a
МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ №2, 2012
60 п
со
3 50-о
л 40-
CU
О 30-
<д
& 20-| ш со о>
i 10-
-10J
non-infected S121 cells Sf21 cells infected with Sf21 cells infected with non-recombinat Bacmid Bacmid-miR-9a
Figure 6. Detection the expression of miR-9a by Real-time PCR. The data are means ± SE (n = 3)
identification of miR-9a is unknown in silkworm.
The gain of miRNAs is an important part for its functional investigation. At present, there are primarily three approaches for the functional research of miRNAs. They are the construction of eukaryotic expression vector, in vitro transcription [13, 14, 33] and direct chemical synthesis [29, 32]. Compared with the chemical synthesis or transcription mature miRNA in vitro, construction of the eukaryotic expression vector should be more economic, and applied in long-term research of its biological functions. Endogenous pre-miRNAs share some similar structural characteristics that comprise a stem, a terminal loop, long flanking sequences, and some internal loops or bulges, which likely contribute to an efficient processing in miRNA pathway [44]. Some experiments confirmed that the flanking sequences besides the pre-miRNA should be necessary for miRNA expression and the sequence flanking pre-miRNA has also been proven critical for pri-miRNA to be processed into pre-miRNA by Drosha-DGCR8 complex [7, 12, 17]. As reported for miR-223, 40 nt of flanking sequence on each side of pre-miR-223 are necessary for the maturation of miR-223 [45]. The miR-30 can be generated correctly and efficiently when the
pre-miRNA is flanked by 22 nt flanking sequences at its 5'side and 15 nt at its 3' side [38] (Sun et al., 2006). Sun et al. also used an extended miR-30 hairpin of 118 nt as a backbone for artificial miRNA expression [24]. Based on these previous results [27, 35, 43], we reasoned that 100 nt flanking sequence on each side of pre-miRNA are essential and sufficient for the processing and maturation of most miRNAs [8]. Eukaryotic expression method is fairly inexpensive and it also solves the problem of long-term target gene suppression in cells and whole organisms.
At present, there are also efficient commercial kits for miRNA expression vector construction, and these expression vectors can express miRNAs only in mammalian cells, but are not suitable for expression of miRNAs in insect cells. The baculovirus expression system has been proven to be a most effective and versatile eukaryotic expression tool and it has been used to express many recombinant foreign interest gene and recombinant proteins [1]. In this paper, we first used baculovirus expression system to generate mature miR-9a. The real-time PCR results showed recombinant bacmid-miR-9a effectively expressed mature miR-9a in infected Sf21 insect cells. Overall, our novel method reported here will be a very
useful tool for the expression of miRNAs, as well as other application related to baculovirus. This method may have broad application in other miRNAs research. Meanwhile, baculovirus expression system will be a good strategy for further function study of miRNAs in vitro and lay a foundation and good technological platform for study of miR-9a in silkworm.
Acknowledgments This research was supported by Doctoral Science Foundation of He Nan University of Science (09001578) and Technology and the Natural Science Foundation of China (31172266).
REFERENCES
1. Bartel, D.P., Cell., 2009, vol.136, pp. 215-233.
2. Huang, Y., Shen, X.J., Zou, Q., et al., J Physiol Biochem., 2010, vol. 67, pp. 129-139.
3. Kloosterman, W.P., andPlasterk, R.H., Dev Cell., 2006, vol.11, pp. 441-450.
4. Lecellier, C.H., Dunoyer, P., Arar, K., et al., Science., 2005, vol. 308, pp. 557-560.
5. Ma, L., Teruya-Feldstein, J., and Weinberg, R.A., Nature., 2007, vol. 449, pp. 682-688.
6. Shin, K.J., Wall, E.A., Zavzavadjian, J.R., et al., Proc Natl Acad Sci U S A., 2006, no. 103, pp. 13759-13764.
7. Trakooljul, N., Hicks, J.A., and Liu, H.C., Anim Genet., 2010, no. 41, pp. 357-364.
8. Xi, Q., Wang, S., Ye, Z., et al., BJU Int., 2010, doi: 10.1111/j.1464-410X.2010.09444.x.
9. Guo, T.Q., Wang, J.Y., Guo, X.Y., et al., Arch Virol., 2005, vol. 150, pp. 93-105.
10. Su, W.J., Wu, Y., Wu, H.L., et al., Pol J Microbiol., 2008, vol. 57, pp. 271-274.
11. Wu, X., Cao, C., Kumar, VS., andCui, W., Res Microbiol., 2004, vol. 155, pp. 462-466.
12. Cheng, A., Li, M., Liang, Y., et al., Oligonucleotides., 2009, vol. 19, pp. 203-208.
13. Feng, J., Wang, K., Liu, X., et al., Gene., 2009, vol. 437, pp. 14-21.
14. Lee, R.C., Feinbaum, R.L., andAmbros, V., Cell., 1993, vol. 75, pp. 843-854.
15. Reinhart, B.J., Slack, F.J., Basson, M, et al., Nature., 2000, vol. 403, pp. 901-906.
16. Griffiths-Jones, S., Saini, H.K., van Dongen, S., and Enright, A.J., Nucleic Acids Res., 2008, vol. 36, pp. D154-158.
17. Huang, Y., Shen, X.J., Zou, Q., Mol Biol (Mosk)., 2011, vol. 45, pp. 225-230.
18. Muller, S., andImler, J.L. Immunity., 2007, vol. 27, pp. 1-3.
19. Pfeffer, S., and Voinnet, O., Oncogene., 2006, vol. 25, pp. 62116219.
20. Sarnow, P., Jopling, C.L., Norman, K.L., Nat Rev Microbiol., 2006 vol. 4, pp. 651-659.
21. Stefani, G, and Slack, F.J., Nat Rev Mol Cell Biol., 2008, vol. 9, pp 219-230.
22. Rossi, J.J., Cell., 2009, vol. 137, pp. 990-992.
23. Valastyan, S., Reinhardt, F., Benaich, N., et al., Cell., 2009, vol. 137 pp. 1032-1046.
24. Bejarano, F., Smibert, P., and Lai, E.C., Dev Biol., 2010, vol. 338 pp. 63-73.
25. Li, Y., Wang, F., Lee, J.A., and Gao, F.B., Genes Dev., 2006, vol. 20 pp. 2793-2805.
26. Biryukova, I., Asmar, J., Abdesselem, H., andHeitzler, P., Dev Biol. 2009, vol. 327, pp. 487-496.
27. Griffiths-Jones, S., Grocock, R.J., van Dongen, S., et al., Nucleic Acids Res., 2006, vol. 34, pp. D140-144.
28. Liu, S., Gao, S., Zhang, D., et al., BMC Genomics., 2010, vol. 11 pp. 85.
29. Hu, T., Chen, P., Fu, Q.,et al., Mol Biotechnol., 2010, vol. 46, pp 34-40.
30. Hu, T., Fu, Q., Chen, P., Int J Mol Sci., 2009, vol. 10, pp. 21582168.
31. Shibata, A., Iwaki, A., andFukumaki, Y, J RNAi Gene Silencing. 2007, vol. 3, pp. 237-247.
32. Ritchie, W., Legendre, M., and Gautheret, D., RNA., 2007, vol. 13 pp. 457-462.
33. Shan, Z., Lin, Q., Deng, C, et al., Mol Biol Rep., 2009, vol. 36, pp 1483-1489.
34. Zeng, Y., Wagner, E.J., andCullen, B.R., Mol Cell., 2002, vol. 9, pp 1327-1333.
35. Fukuda, Y., Kawasaki, H., and Taira, K. Methods Mol Biol., 2006 vol. 338, pp. 167-173.
36. Han, J., Lee, Y., Yeom, K.H., et al., Cell., 2006, vol. 125, pp. 887-901.
37. Huang, Y., Zou, Q., Wang, S.P., et al., J Zhejiang Univ Sci B., 2011 vol. 12, pp. 527-533.
38. Zhou, H., Xia, X.G., andXu, Z., Nucleic Acids Res., 2005, vol. 33 pp. e62.
39. Sun, D., Melegari, M., Sridhar, S., et al., Biotechniques., 2006, vol 41, pp. 59-63.
40. Molnar, A., Bassett, A., Thuenemann, E., et al., Plant J., 2009, doi 10.1111/j.1365-313X.2008.03767.x.
41. Qiu, L., Wang, H., Xia, X., et al., BMC Biotechnol., 2008, vol. 8, pp 77.
42. Silva, J.M., Li, M.Z., Chang, K., et al., Nat Genet., 2005, vol. 37, pp 1281-1288.
43. Xu, J., Zeng, J.Q., Wan, G., et al., BMC Biotechnol., 2009, vol. 9 pp. 53.
44. Gou, D., Zhang, H., Baviskar, P.S., and Liu, L., Physiol Genomics. 2007, vol. 31, pp. 554-562.
45. Likhoradova, O.A., Ogai, I.D., Podpisnova, M.M., et al., Mol Biol (Mosk)., 2008, vol. 42, pp. 370-377.
