CC BY
60Russian Journal of Nematology, 2022, 30 (2), 161 - 173
Biodiversity of parasitic nematodes associated with hot pepper (Capsicum spp.) in Jimma area, Ethiopia
Shiferaw Demissie Tola1, Beira Hailu Meressa1, Diriba Muleta2 and Fassil Assefa2
'College of Agriculture and Veterinary Medicine, Jimma University P.O. Box 307, Jimma, Ethiopia 2Institute of Biotechnology, Addis Ababa University, P.O. BOX 1176, Addis Ababa, Ethiopia
e-mail: beira.hailu@ju.edu.et
Accepted for publication 2 June 2022
Summary. In recent years, it has been realised that the damage of peppers is increasing markedly due to temporal and spatial variations of plant-parasitic nematodes. In order to protect the crop from these nematodes, there is a need for an intensive survey, and accurate identification of these pathogens from the complex tropical and sub-tropical agricultural system. To this end, a total of 105 soil samples were collected (in 2017 and 2018) from the rhizosphere of pepper plant in major pepper-grown areas for nematode detection. Results showed 83.3, 87.5, 88.9 and 93.8% of the fields surveyed in Sekoru, Kersa, Shabe Sombo and Omo Nada districts of Ethiopia harboured nematodes that were identified into 13 genera, of which six genera were frequently and abundantly recovered from most of the surveyed areas including Meloidogyne, Scutellonema, Rotylenchulus, Helicotylenchus, Pratylenchus and Rotylenchus. Molecular analysis also showed that all the root-knot nematodes were Meloidogyne incognita. The Pearson correlation analysis indicated that soil EC (r2 = 0.914) and sand content (r2 = 0.864) had strong positive correlation with the nematode density of major pepper parasitic nematodes, while organic matter (r2 = -0.96) showed strong negative correlation. Therefore, further study is needed to assess the damage level caused to hot pepper for appropriate management strategies of the nematode. Key words: Meloidogyne incognita, nad5 gene, nematode survey, pepper rhizosphere, soil properties.
Hot pepper (Capsicum spp.) is widely grown for consumption as a vegetable, spices, oleoresin, and also as an industrial additive and medicine (Saleh et al., 2018). Globally, ca 752,000 tonnes of peppers with annual revenue of US$ 4.1 billion were produced in 2018 (World Pepper Market, 2020). Vietnam is the largest pepper producing country in the world (302,866 t), while Ethiopia is the 11th high producing country with a production of 4,798 t (https://www.nationmaster.com/nmx/ranking/pepper-production-fao) contributing to only 0.8% of the world production (Gobie, 2019). It is established that the volume of pepper production is increasing annually by 3.2% over the previous years, but the yield is fluctuating from season to season (CSA, 2020/21) due to various biotic and abiotic factors (Kang et al., 2020). Abiotic stresses include soil infertility, salinity, drought and cold, whilst biotic factors comprise rots, mildew and wilting (Chhapekar et al., 2018). Moreover, pepper production is constrained by a shortage of improved varieties, high cost of farm inputs, instability of markets and post-harvest processing (Mohammed, 2016).
It has been realised that the major causative agents for the reduction of pepper production are the fungal
pathogens viz. Phytophthora causing foot rot and blight, Fusarium wilt, Anthracnose (fruit rot), Cercospora leaf spot, bacterial and viral diseases, and stunting, yellowing and wilting of pepper caused by plant-parasitic nematodes (hereafter, nematodes) (Admassie et al., 2017; Abd-Elgawad, 2020; Demissie et al., 2020; Parisi et al., 2020). Nematodes, such as Meloidogyne spp., Tylenchorhynchus sp. and Helicotylenchus sp. have been indicated as major parasites of pepper plants (Adamou et al., 2013). Abd-Elgawad (2014) indicated the annual yield loss of pepper by nematodes was 22%. Although Meloidogyne spp., are well understood as major constraints to pepper production elsewhere (Bommalinga et al., 2013), there is limited research work in Ethiopia, particularly in the Jimma area.
Mandefro and Mekete (2002) attempted to indicate the incidence of Meloidogyne spp. on vegetables in general without determining pepper-associated nematodes separately. Regardless of the common leaf wilting and yellowing observed, no formal work has been conducted on the occurrence and distribution of nematodes on hot pepper crop in most of the major pepper-producing areas of Jimma Zone.
© Russian Society of Nematologists, 2022; doi: 10.24412/0869-6918-2022-2-161-173 Published online 20 December, 2022
Furthermore, soil physicochemical properties such as soil pH, texture, cation-exchange and organic contents are considered to be strongly correlated with nematode infections (Palomares-Rius et al., 2015; Kawanobe et al., 2020). Consequently, this study also focused on the analysis of physicochemical properties of soil samples collected from the study sites in order to establish the association of nematodes' infection with edaphic factors.
Consequently, the current study was aimed at determining the occurrence and distribution of dominant nematodes in the major hot pepper growing districts of Jimma Zone and the findings could serve as basis for choosing the most suitable management strategies and also to extend the survey in other pepper growing parts of Ethiopia. In addition, the study will illustrate the relationship between the nematode distribution and crop age as well as variation between cropping seasons. The results of this study would also provide important information on soil physicochemical properties that have a remarkable impact on the composition of nematode communities in pepper fields. Therefore, a comprehensive sampling of nematodes was undertaken in four districts of Jimma zone: i) to assess the abundance and prevalence of major nematodes genera associated with pepper; ii) to identify molecularly the Meloidogyne spp. isolated from the study sites; and iii) to evaluate soil physicochemical properties of the study sites in relation to the occurrence of nematodes.
MATERIAL AND METHODS
Survey area. This survey was conducted in four selected districts of Jimma zone, including Kersa, Omo Nada, Sekoru and Shabe Sombo (Fig. 1), which are located at 22, 68, 108 and 67 km, respectively, from Jimma town. Jimma zone is situated between 7°15'-8°45'N and 35°30'-37°30'E with an altitude ranging from 880 to 3360 m a.s.l. (Demmirew et al., 2018). Jimma has an agro-ecological setting of highlands (15%), midlands (67%) and lowlands (18%). It receives an average annual rainfall that ranges from 1200-2800 mm. The minimum and maximum daily temperatures of the study sites are 10°C and 32°C, respectively. Pepper production is considered to be the major crop of most districts of the zone. This survey was carried out during 2017-2018 for two cropping seasons.
Sampling and nematode extraction. Pepper fields in the selected major pepper growing districts of Kersa, Omo Nada and Sekoru were surveyed for two consecutive years (2017-2018) from mid of
September to the end of October (cropping season). Accordingly, a total of 105 crop fields, i.e. 48 from Omo Nada, 24 from Kersa, and Sekoru each and 9 from Shabe Sombo districts were sampled. The sampling was done along the main and all accessible rural roads. Hot pepper fields were randomly selected and assessed systematically in a diagonal pattern.
During sampling, the pepper plants were about 105-130 days old. From each field, two composite samples were taken using a soil probe. Accordingly, 20 soil cores (about 1 kg per sample) were collected from the top 20-25 cm depth of the pepper plant rhizosphere. After thoroughly mixing by hand, a sub-sample of a half kg of soil was put into labelled plastic bags (Meressa et al., 2014). Thereafter, samples were transported to the laboratory, and stored at 5°C until further analysis.
Nematodes were extracted from the whole pepper root system (after cutting the roots into 2-3 cm long pieces) and 100 ml aliquot of soil separately using modified Baermann method over an incubation period of 48 h (Hooper et al., 2005). After collecting the nematodes on a 38 ^m sieve, they were rinsed into a 100 ml polypropylene bottle and stored at 5°C until further analysis.
Nematode identification and enumeration.
For each sample, two separate 1 ml aliquot of nematode suspensions were added into a nematode counting slide chamber, identified to a genus level and quantified under a light compound microscope (*100) (A. KRUSS OPTRONIC, Germany). The nematode density of each genus per 100 ml of soil was determined and converted to numbers of nematodes per litre of soil (N/L) (Sawadogo et al., 2009).
The prevalence of nematodes was determined based on their frequency of occurrence (FO) and abundance (Abs). The FO of the nematode genus was calculated from the number of samples in which the nematode was observed divided by the total number of samples taken (E), multiplied by 100 to express as a percentage. Abundance was also calculated as the sum of N/L for all samples containing that nematode, divided by the number of positive samples for that nematode and expressed as a decimal logarithm (log x + 1). Following Sawadogo et al. (2009), the thresholds of nematodes for abundance and frequency were determined. Nematodes were considered as abundant in the soil if abundance > 2.3 (200 indiv. (l soil)_l), and frequent when they were observed in at least 30% of the soil samples.
Establishment of Meloidogyne pure population. Meloidogyne spp. were baited from soil samples collected from pepper fields using susceptible tomato
36*0'0"E
Fig. 1. Map showing the sampled fields of major pepper growing districts in Jimma Zone.
rootstock (Solanum lycopersicum 'Marglobe') under glasshouse conditions. Samples from each site were filled separately into 2 l plastic pots that were partially filled with sterilised sand into which tomato seedlings were transplanted individually. After 8 weeks, the tomato plants were carefully uprooted and examined for nematodes establishment.
Egg masses were individually handpicked with forceps from the galled tomato roots and incubated to hatch in an Eppendorf tube with sterilised distilled water. The newly hatched second-stage juveniles (J2) were then inoculated into tomato seedlings planted in a 200 ml capacity transparent plastic cups that were filled with sterilised sandy soil and maintained for 8 weeks in a glasshouse. After successive reinoculations and multiplying on tomato rootstocks in a 1 l plastic pots filled with sterilised sandy soil, the J2 of each nematode isolate were extracted from the respective tomato roots and used for molecular identification, while females were used for morphological identification (Meressa et al., 2015). The nematode reproduction was done in a glasshouse with an average air temperature of 21°C, relative humidity of 81% and 12 h photoperiod.
Molecular characterisation of Meloidogyne sp. Nine Meloidogyne isolates (each cultured from a single egg mass) were used for molecular study that randomly selected from the sampling areas.
DNA extraction and amplification. Genomic DNA was extracted from a single J2 nematode cut into 2-3 pieces using a sterile needle and transferred into a PCR tube containing 20 ^l of worm lysis buffer (50 mM KCl, 10 mM Tris at pH 8.3, 2.5 mM MgCl2, and 0.45% NP 40 (Tergitol Sigma), 0.45% Tween-20) and frozen for 10 min at -20°C. A 1 ^l of proteinase K (1.2 mg ml-1) was added to each tube and incubated in a PCR machine at 65°C for 1 h, and 10 min at 95°C. Thereafter, the lysate was centrifuged at 4350 g. PCR assay was done by using 25.55 ^l of Mastermix (17 ^l distilled sterile water; 2.5 ^l 10X buffer; 2 ^l MgC^; 2.5 ^l Coralload; 0.5 ^l dNTP (10 mM); 0.5 ^l of each primers; 0.05^l Top Taq) and 4 ^l of DNA template. The primers Nad5-Oli-F (GGG AAG CAT TAT CAG GGG CTT TG) and Nad5-Oli-R (TTC CTT CGG ACT TTT TAT AAC GTG) were used to amplify the mitochondrial nad5 gene. The PCR reaction was set for the denaturation at 94°C for 5 min with five cycles (94°C, 54°C and 72°C for 30 s at each temperature), followed by 35 cycles of (94°C, 50°C and 72°C for 30 s), and a final extension for 10 min at 72°C. The reaction was run in BIO-RAD, T100 Thermocycler (Bio-Rad Laboratories (Singapore) Pte. Ltd.). PCR products (5 ^l) were separated on 1% agarose gel electrophoresis, stained with GelRed and visualised using a UV Transilluminator.
Sequence analysis. Following amplification of the nad5 gene, PCR products were purified and sequenced in both directions at Macrogen Inc. (Amsterdam, The Netherlands). The raw sequences were visualised using Chromas and low-quality sequences were edited using BioEdit version 7.0.5, and then subjected to the BLAST engine for sequence similarity search in GenBank NCBI database. Both the new sequences and those retrieved from the GenBank database (Table 1) were aligned using ClustalW (Tamura et al., 2011; Meressa et al., 2015). Pairwise distance between newly identified M. incognita isolates and other Meloidogyne spp. obtained from the database were analysed by MEGA version 10.2.2. Values of the relative base frequencies were also estimated. The variability or similarity in nucleotide position of new isolates and those obtained from the GenBank (MH00502, Kenya; MG948250, South Africa; KY522752, Nigeria; MK557986, China, MK557979; Japan; MK038888, Vietnam; and MN10603 5, Colombia) were compared using Unipro UGENE Version 37.
Phylogenetic analysis. Newly obtained sequences of nad5 mtDNA gene plus related published sequences from GenBank as well as Bursaphlenchus xylophilus (JN596459) chosen as an outgroup taxon were used to reconstruct the phylogenetic trees using the neighbour-joining method (NJ). The support for each branch was estimated using the bootstrap method with heuristics search and 1000 replicates.
Soil physicochemical analysis. Soil physicochemical parameters were determined from the same soil samples from which nematodes were extracted. Soil samples were air-dried and sieved through a 2 mm mesh. Physicochemical properties that included electrical conductivity (EC), pH, soil texture, organic matter content, cation exchange capacity and available phosphorous were analysed accordingly. The soil pH and EC parameters were measured from soil suspension prepared in 1:2.5 (w/v) soil water ratios using pH and EC meters (HANNA instrument, Portugal) (Jackson, 1967). Soil texture was determined using the hydrometric method (Gee & Bauder, 1986). The hydrometer readings were taken after the 40 s and 2 h (Kamara et al., 1992). Organic matter was determined following the method of Walkey and Black (1934), while the percentage of carbon and total nitrogen (TN) were calculated from the percentage organic matter (OM) with their respective empirical factors. Available phosphorus was extracted using Brady and Weil (2002). Cation exchange capacity (CEC) was determined by the ammonium acetate method.
Data analysis. The nematode frequency and abundances were computed using Microsoft Excel 2010 version 365. The sequence of M. incognita was analysed using MEGA version 10.2.2 and Unipro UGENE Version 37. Correlation of soil physico-chemical properties and distribution of nematode genera were calculated using the Minitab® version of 19.
RESULTS
Hot pepper associated nematodes (Capsicum spp.). From this survey, nematodes were detected in 83.3, 87.5, 88.9 and 93.8% of the fields surveyed in Sekoru, Kersa, Shabe Sombo and Omo Nada, respectively. A total of 11 (2017) and 13 (2018) nematode genera were detected from the pepper rhizosphere during pepper cropping seasons. Accordingly, 5, 7, 11 and 12 genera were identified from Shabe Sombo, Kersa, Sekoru and Omo Nada districts, respectively. Although more than 73% of pepper rhizosphere soil samples were positive for Meloidogyne sp. and visible damage of roots symptomatic of nematode infection was observed during sample collection, both Meloidogyne and Pratylenchus were not detected from pepper root samples. The genera of Meloidogyne, Scutellonema, Rotylenchulus, Helicotylenchus, Pratylenchus and Rotylenchus were determined as the most frequent and abundant in the sampled fields of hot peppers (Fig. 2).
The pepper damaging nematodes were categorised into three groups by sectioning plots of abundance by frequency into quadrants following the threshold of nematode frequency and abundance described by Sawadogo et al. (2009) (Fig. 2). Thus, the first group that are characterised by high abundant and frequent nematode genera were: Meloidogyne (Abs = 3.9-4.2; FO = 72.8-88.9) and Scutellonema (Abs = 3.3-4.0; FO = 33.3-77.8) in all of the districts, Rotylenchulus (Abs = 2.8-3.8; FO = 30-48) in Kersa, Omo Nada and Sekoru, Rotylenchus (Abs = 3.1; FO = 33.3) and Helicotylenchus (Abs = 2.9; FO = 66.7) in Shabe Sombo. These nematodes were positioned in the upper right quadrant of the plot, i.e. in both cases above the assigned thresholds.
Except in Sekoru, Pratylenchus (Abs = 2.4-3.3) was aligned in the upper left quadrant in which it was abundant but less frequent, hence classified as a second group. The other seven nematode genera positioned in the lower-left quadrant that were less abundant and frequent, assigned as third grouped (Fig. 2), were Hoplolaimus, Paralongidorus, Paratrichodorus, Trichodorous, Trophurus, Tylenchorhynchus and Tylenchus.
Sbabe Sombo
4.5
4.0
+ 35
■a 0 3.0
Ta
= 2.5
■z.
8? 2.0
1 5
5
S 1.0
£
0.5
0.0
Pratylenchus ♦ Helicotylenhiu ^Meloidogyne Scuiellonema ♦ Rotylenchus
10 20 30
40 50 60
Frequency (%)
70 80 90 100
4.5 4.0 -3.5 I 3.0
s
z
5 2.5 r a ¿2.0
1 1.5
r
< 1.0
0.5 0.0
Helicoylenchis ♦ Meloidogyne * Roqlenchidus * Scuiellonana
^ « Rofylenchic + Tylenchortyyichu Paramchcdonis ♦ Hoploomtus * Paralongldonc Trophuw ♦ jyickodoms
4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0
(
4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0
Heliconienchus ♦ Prahlenchus ♦ Meloidogyne ♦ ♦ Rotylenchulus * Scuiellonema
♦ Rotylenchus ♦ Tyimchus
20
Sekoru
40
Frequency (°'o)
60
80
Hellco^lenclius ♦ Tylenchorliynchus ♦ Rohlenchulus Meloidogyne ♦ ♦ Scuiellonema
, Pratylenchus Rotylenchus * Trlcliodorm • Paralongtdorus Paratrichodorus . ♦ Tylenchus
40 50
Frequencyt9«)
30 40 50
Frequeacv(%)
Fig. 2. Frequency (percentage of positive samples) and abundance (mean numbers per sample) of the plant-parasitic nematode genera associated with hot pepper rhizosphere samples from four districts of Jimma Zone (2017-2019) in Ethiopia.
Table 1. nad5 gene of currently isolated Meloidogyne incognita and other Meloidogyne species obtained from GenBank
used for phylogenetic analysis.
Altitude Sample code and accession numbers of current isolates Nematode spp. and accession numbers Reference and country of origin
1753-1804 B26-50, B26-51, B26-61 (KU372361) M. incognita (MG948250) M. javanica (MG948245) Rashidifard et al, 2019; South Africa
M. enterolobii (MG920328) Rashidifard et al, 2019; South Africa
M. incognita (MH005027) Chitambo et al., 2019; Kenya
M. incognita(MH399841) Chitambo et al., 2016; Kenya
M. javanica(MH005023) Chitambo, 2018; Germany
M. arenaria(MK557999) M.incognita(MK557986) Liu et al., 2019; China
1777-1842 LA26-76, LA 26-77 (KU372361) M. incognita (MK557979) Liu et al., 2019; Japan
B. xylophilus (JN596459) Pereira et al., 2013; Japan
M. incognita( MN106035) M. arenaria (MN106026) Riascos et al., 2019; Colombia
1720-1842 L26-66, L26-67, L26-68, C26-82(KU372361) M. floridensis(MH729181) M. incognita(MK038888) M. incognita(MK038889) Westphal et al., 2018; (CA) USA Trinh et al., 2019; Vietnam
M. enterolobii(MK038895) Trinh et al., 2019; Vietnam
M. incognita (KY522752) Kolombia et al., 2017; Nigeria
M. ethiopica (KU372360) Janssen et al., 2016; Brazil
Fig. 3. PCR products of nad5 gene from nine Meloidogyne incognita isolates on a 1% agarose gel. L1-9 = Lanes of isolates. L1 (C26-82), L 4 (L26-68), L5 (L26-67) and L6 (L26-66) isolates from pepper fields of Sekoru district; L2 (LA 26-77) and L3 (LA26-76) from Omo Nada; L7 (B26-61), L8 (B26-51) and L9 (B26-50) from Kersa district; while M = DNA ladder.
MG94825T TTTTT AAT AGAGAATAGT TTAATAGATATAATAAGGATTT TTATTTATAAGAT GTT TAACTAAAAGTT CACAGTTTC 81
B26-50 ............................................................................................................................................................81
B26-51..........A. A............A........................................A......................81
B26-61............................................................................C. 81
L26-66 ............................................................................................................................................................81
L26-67 ............................................................................................................................................................81
L26-68 -................A.......................................................C. . . . 80
LA26-76 ............................................................................................................................................................81
LA 26-77 ............................................................................................................................................................81
C26-82 ............................................................................................................................................................81
MG94825CTT TTTTTGGTTGATTGGT GAAAGCTAT GGTGGCACCAACTCCTGTTAGTTCATTGT TCATAGAAGAACATTAGTT GT 157
B26-50 ............................................................................................................................................................157
B26-51 ........AT. . AG...........................................................A. . . . 157
B26-61 ............................................................................................................................................................157
L26-66 ............................................................................................................................................................157
L26-67 ............................................................................................................................................................157
L26-68 .........A........................................................................................................................................156
LA26-76 ............................................................................................................................................................157
LA 26-77 ............................................................................................................................................................157
C26-82 ............................................................................................................................................................157
MG94825TTCTGGTTGTTT - - TTTAATGTATATTTATTTTGAGAATTATAATTTTAATT - TTATAATATTTTTATTTTTAATTAG 233
B26-50 ............- -......................................-..................................................233
B26-51 ............- -......................................-..................................................233
B26-61 ............- -......................................-..................................................233
L26-66 ............- -......................................-..................................................233
L26-67 ............- -......................................-..................................................233
L26-68 ............- -......A...............................-..................................................232
LA26-76 ............- -......................................-..................................................233
LA 26-77 ............- -......................................-..................................................233
C26-82 ............- -......................................-..................................................233
MG94825T TTATT GGGAAT ATT AAT TTCT CTAATATTAAGATGTAAAAAAAATAGTAGCTT ATAGAACTATAT CTCAGTTAGTTT 310
B26-50 ............................................................................................................................................................310
B26-51 ............................................................................................................................................................310
B26-61 ............................................................................................................................................................310
L26-66 ............................................................................................................................................................310
L26-67 ............................................................................................................................................................310
L26-68 ................................A..........................................................................................309
LA26-76 ............................................................................................................................................................310
LA 26-77 ............................................................................................................................................................310
C26-82 ............................................................................................................................................................310
MG94825GATTTTTTTGTTTTTTAGTTATGGTTGATTTT - TTTGATCTTTATTATATTTAATTAAT - - 367
B26-50 ................................-..........................- - 367
B26-51 ................................-........................C------367
B26-61 ................................-..........................- - 367
L26-66 ................................-..........................- - 367
L26-67 ................................-..........................- - 367
L26-68 ................................-..........................- - 366
LA26-76 ................................-..........................- - 367
LA 26-77 ................................-..........................- - 367
C26-82 ................................-..........................- - 367
Fig. 4. Alignment of nad5 genes of ten Meloidogyne incognita isolates. Nine isolates are newly identified isolates, while MG948250 is from GenBank originally from South Africa. Identical nucleotide positions are indicated with "." Indels are indicated with "-".
Table 2. Sequence similarity (%) of nad5 genes of nine Meloidogyne incognita isolates from Ethiopian hot pepper rhizosphere and the sequences of other isolates from GenBank database are shown with their corresponding accession number.
Isolates* M. incognita populations
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15
01 B26-50 -
02 B26-51 97 -
03 MG948250 (SA) 100 97 -
04 B26-61 100 97 100 -
05 L26-66 100 97 100 100 -
06 MH005027 (KY) 100 97 100 100 100 -
07 L26-67 100 97 100 100 100 100 -
08 L26-68 98 96 98 98 98 98 98 -
09 MK557986 (CH) 100 97 100 100 100 100 100 98 -
10 LA26-76 100 97 100 100 100 100 100 98 100 -
11 LA 26-77 100 97 100 100 100 100 100 98 100 100 -
12 KY522752 (NG) 100 97 100 100 100 100 100 98 100 100 100 -
13 C26-82 100 97 100 100 100 100 100 98 100 100 100 100 -
14 MK557979 (JP) 100 97 100 100 100 100 100 98 100 100 100 100 100 -
15 MN106035 (CB) 100 97 100 99 100 100 100 98 100 100 100 100 100 100 -
15 MK038888 (VM) 100 97 100 99 100 100 100 98 100 100 100 100 100 100 100
*SA (South Africa); KY (Kenya); CH (China); JP (Japan); CB(Colombia); VM (Vietnam); NG(Nigeria).
PCR assay of Meloidogyne spp. The amplification of the nad5 gene of the mtDNA region produced a single fragment of PCR product of about 535 bp. All of the nine Meloidogyne isolates produced the same fragment size (Fig. 3).
Identification of Meloidogyne incognita isolates. The sequences and phylogenetic analysis results confirmed that all of the root-knot nematode isolates belonged to M. incognita. A similarity search at NCBI for nad5 gene sequences confirmed the species identity of the isolates. Except, B26-50, B26-61, LA26-77 and C26-61 (99.5%), the remaining isolates revealed 100% similarity with M. incognita isolates of different origin retrieved from Genbank (MH005027, Kenya), (MG948250, South Africa), (MK557986, China), (MK557979, Japan) and (KY522752, Nigeria), while all isolates had less similar (85%) to M. enterolobii (Rashidifard et al., 2019).
Characterisations of the nucleotides. The distance between the new sequences varied from 0.0-0.04 bp. The final nad5 sequence alignment contained 373 positions with 64 parsimony informative sites and 351 conserved regions. Within the Ethiopian isolates, there were four groups based on A+T richness: 74.1%, 78.4%, 79.8% and 86.9%. All the M. incognita isolates including those obtained from the database revealed sequence
similarities that ranged from 96-100%. Relatively, higher nucleotides variation (96-98%) occurred between B26-51 and B26-68 and the rest of the isolates including those extracted from the database (Table 2).
Nucleotide position in nad5 gene sequence.
Sequence alignments of the nad5 region were compared between the identified isolates and an isolate from South Africa (MG948250) (Fig. 4). Among the sequences of 10 isolates, 20 variable positions were obtained, in which there were 13 transitions (12 GA; 1 TC), 3 transversions (1 AC, 1 GT and 1 GC) and 4 indels (T). The highest nucleotide variations (11 nucleotides) were observed between the MG948250 and B26-51 isolate.
Phylogenetic analysis. The analysis of nad5 gene using the neighbour-joining method was able to infer the phylogenetic relationship among the Meloidogyne spp. The topology of the tree is represented by the NJ tree, with the respective bootstrap values. Although a single Meloidogyne species was detected from the pepper fields of the study areas, variation was observed among isolates regardless of sample collection site. All the newly identified M. incognita isolates formed highly supported clades with those of published M. incognita that were isolated from different geographical origin (Fig. 5).
Fig. 5. Neighbour-joining method analysis of nad5 gene (mtDNA) of Meloidogyne incognita isolates from Ethiopian hot pepper rhizosphere and other related sequences. Sequences from GenBank are given their corresponding accession number in parenthesis with their countries of origin. Newly obtained sequences are indicated with their isolate code in parenthesis. The analysis was performed using 1000 bootstrap replicates; values above 50% are shown on each node. Bursaphelenchus xylophilus was used as the outgroup taxon.
Phylogenetic analysis of nad5 gene sequences of M. incognita, which was currently isolated and retrieved from GenBank, as well as others isolates of Meloidogyne spp., obtained from GenBank formed two highly supported clades. Clade I includes M. enterolobii and Clade II contains all M. incognita including currently identified isolates with a bootstrap value of 72%. Except for B26-51 and L26-68, the remaining M. incognita isolates were located between M. incognita isolates originated from Colombia and South Africa (Fig. 5).
Correlation between soils physicochemical properties and nematode density. The correlation analysis was performed for all of the identified nematode genera but the results were presented for the six genera of economically important nematodes affecting pepper, including Helicotylenchus, Meloidogyne, Pratylenchus, Rotylenchulus, Rotylenchus and Scutellonema. Soil EC (r2 = 0.914) and sand content (r2 = 0.864) showed a strong positive correlation with the nematode density, but showed weak correlation with available phosphorus
Fig. 6. Correlation analysis of the six nematode genera (Helicotylenchus, Meloidogyne, Pratylenchus, Rotylenchulus, Rotylenchus and Scutellonema) and physicochemical characteristics of soil collected from the major pepper growing area of Jimma Zone.
(r2 = 0.2) and silt content (r2 = 0.197). On the other hand, total nitrogen (r2 = -0.76), soil pH (r2 = -0.702) and organic matter (r2 = -0.96) had a strong negative correlation (Fig. 6); in addition, organic carbon (r2 = -0.65), and clay content (r2 = -0.50) depicted moderate negative while cation exchange capacity (r2 = -0.07) revealed weak correlation with nematode density.
DISCUSSION
This study provided detailed information on the diversity and distribution of nematodes associated with hot pepper in the study area. Previous studies in Ethiopia had been limited to the nematodes associated with various vegetables (Tefera & Huluka, 2000; Mandefro & Mekete, 2002), but not from the major pepper cultivating fields of Jimma zone. From the two season's survey, 11 genera in 2017 and 13 genera of nematodes in 2018 were recorded from the pepper rhizosphere. However, no endoparasitic nematode genus was recovered from pepper roots, which could be due to dislodging of the nematodes from the old roots into the soil at the time of sample collection. Most of the soil sample collection from the Omo Nada district was positive for nematodes
that could be ascribed to the cultivation of pepper for a long period of time contributing to the presence of nematodes in higher abundance.
Our study revealed that Meloidogyne spp. and Scutellonema spp. were abundant and frequent in all of the surveyed areas. Accordingly, 73-89% of the samples collected from pepper fields were infested with Meloidogyne spp. and considered as the major pest of pepper in this study. Baimey et al. (2009) described Meloidogyne spp. as a dominant nematode on vegetables in subtropical and tropical regions. During sample collection, we observed significant symptoms of pepper root galling, wilting and stunted growth in most of the fields. In addition, to the direct interference with the growth of crops, root-knot nematodes are well known to form disease complexes with various soil-borne fungi that cause wilting, thereby intensifying damage to crops (Kassie, 2019). Likewise, Mandefro and Mekete (2002) found 62% of vegetables fields infested with Meloidogyne spp. with a predominance of M. incognita based on samples collected from 192 fields of vegetables growing in two seasons of Ethiopia. Adamou et al. (2013) also found the genus Meloidogyne as predominant and the most important nematode parasites of pepper in Niger.
Similar to the finding of Baimey et al. (2009), large nematode density of the Rotylenchulus and Helicotylenchus genera were frequently detected from most sampled fields. The presence of these nematodes indicates the potential damage to the pepper crop. Scutellonema was not a common genus in pepper rhizosphere (Adamou et al., 2013), but our results showed this genus as highly prevalent, even though its damage potential to pepper needs to be further assessed. The detection of nematodes from all of the survey areas is an indication that the hot pepper fields in Jimma zone are generally infested with nematodes.
Using nad5 gene, all the Meloidogyne isolates analysed were identified as M. incognita, suggesting its dominance in the areas. Janssen et al. (2016) indicated the robustness of nad5 gene to identify tropical root-knot nematodes that have closely related lineages. This is the first report of molecular characterisation of M. incognita from Ethiopian hot pepper rhizosphere samples corroborating the previous morphological characterisation of the same species as a dominant nematode collected from various vegetables (Tefera & Huluka, 2000; Mandefro & Mekete, 2002). Similarly, Aguiar et al. (2014) have previously identified all the Meloidogyne isolates from Bell pepper farm as M. incognita. The dominance of M. incognita in pepper fields confirms the significance of this nematode as a major threat to vegetables in subtropical and tropical agriculture.
Understanding the effect of soil properties on nematodes communities is an important step to designing feasible management strategies. Directly or indirectly nematodes are affected by soil factors such as soil compactness, OM content (support the proliferation of phytobenefical microbes that are antagonistic to nematodes), nitrogen content (nematicidal effect during ammonification of the organic nitrogen), acidity (affect nematode physiology), moisture and EC, which are required for nematode activities (Yavuzaslanoglu et al., 2012; Mokrini et al., 2019).
The density of potential nematodes genera, such as Helicotylenchus, Meloidogyne, Pratylenchus, Rotylenchulus, Rotylenchus and Scutellonema, was strongly correlated with soil EC and sand content, whilst there was a high negative correlation with total nitrogen, soil pH and organic matter content. A large number of nematode genera were obtained from the pepper fields of the Omo Nada district. It could happen because of the soil texture of the district dominated by a sand fraction and sandy clay loam, which is suitable for the active movement of nematodes. Noling (2003) recorded a large number
of Meloidogyne spp. and Pratylenchus spp. from sandy soils.
The highest mean density of Meloidogyne spp. and Rotylenchulus spp. were obtained from Omo Nada where the amount of %OM was low, which might be due in part to the low density of phytobeneficial microbes that might antagonise the parasitic nematodes. Meloidogyne spp. was found suppressed in soil amended with organic matter (McSorley, 2011). Mokrini et al. (2019), similarly reported a negative relationship between nematodes and soil organic matter content. The authors remarked that the suppression of nematodes with organic matter decomposition could be due to the release of compounds toxic to nematodes, such as organic acid which in turn might have improved the build of and nematode antagonists and crop nutrition, which ultimately enhances plant growth and tolerance to parasitic worms. Few nematode genera were recorded from the Shabe Sombo district, where the soil is fertile and suitable for microbial proliferation.
In conclusion, more than 83% of pepper fields were infested with nematodes. Meloidogyne incognita was determined as a major pest of hot peppers. Comparatively, large numbers of nematodes were detected from Omo Nada district where intensive pepper cultivation with limited rotation is practised. Most of the soil physicochemical properties, such as the soil texture, enhanced the population density of potential pepper parasitic nematode. To reduce the damage of nematodes to pepper crops, screening the available pepper genotypes for resistance is advisable, in addition to searching for effective bioagents. Furthermore, organic matter application to the soil with manure and compost would reduce the density of nematodes below the damaging level. The present finding can serve as baseline information for further study on nematode-pepper association with emphasis on selection of resistant varieties to increase productivity of pepper.
ACKNOWLEDGEMENTS
The first author was financially supported by the Ministry of Education Ethiopia and EBTI project of Addis Ababa University.
REFERENCES
Abd-Elgawad, M.M.M. 2014. Yield losses by phytonematodes: challenges and opportunities with special reference to Egypt. Egyptian Journal of Agronematology 13: 75-94.
Abd-Elgawad, M.M.M. 2020. Biological control agents in the integrated nematode management of pepper in Egypt. Egyptian Journal of Biological Pest Control 30: 70-80. DOI: 10.1186/s41938-020-00273-6
Adamou, H., Mamame, N.K., Adamou, B., Ali, D. & Toudou, A. 2013. Plant parasitic nematode communities associated with pepper crops in Aguie Region (Niger Republic). Botany Research International 6: 01-06. DOI: 10.5829/idosi.bri. 2013.6.1.503
Admassie, M., Handiso, S. & Alemu, T. 2017. In vitro and in vivo evaluation of antagonistic microbes against pepper anthracnose (Colletotrichum capsici (syd.) Bisby and Butler). International Journal of Environmental Sciences 6: 87-93.
Aguiar, J.L., Bachie, O. & Ploeg, A. 2014. Response of resistant and susceptible bell pepper (Capsicum annuum) to a Southern California Meloidogyne incognita population from a commercial bell pepper field. Journal of Nematology 46: 346-351.
Baimey, H., Coyne, D., Dagnenonbakin, G. & James, B. 2009. Plant-parasitic nematodes associated with vegetable crops in Benin: relationship with soil physico-chemical properties. Nematologia Mediterranea 37: 225-234.
Bommalinga, S., Narasimhamurthy, T.N., Prahalada, G.D. & Reddy, B.M.R. 2013. Screening of bell pepper cultivars against root-knot nematode Meloidogyne incognita [(Kofoid and White) Chitwood]. International Journal of Life Sciences Biotechnology andPharma Research 2: 225-228.
Brady, N.C. & Weil, R.R. 2002. The Nature and Properties of Soil. USA, Prentice-Hall. Inc. 740 pp.
Chhapekar, S.S., Jaiswal, V., Ahmad, I., Gaur, R. & Ramchiary, N. 2018. Progress and prospects in Capsicum breeding for biotic and abiotic stresses. in: Biotic and Abiotic Stress Tolerance in Plants (S. Vats Ed.). pp. 279-322. Singapore, Springer. DOI: 10.1007/978-981-10-9029-5_11
Chitambo, O. 2018. Meloidogyne javanica isolate TIG20 NADH dehydrogenase subunit 5 gene, partial cds; mitochondrial. Molecular Phytomedizin, University of Bonn, Karlrobert-Kreiten-Str. 13, Bonn 53229, Germany. URL: https://www.ncbi.nlm.nih.gov/ nuccore/MH005023.1?report=GenBank (accessed June 22, 2021).
Chitambo, O., Haukeland, S., Fiaboe, K.K.M., Kariuki, G.M. & Grundler, F.M.W. 2016. First report of the root-knot nematode Meloidogyne enterolobii parasitizing African nightshades in Kenya. Plant Disease 100: 1954. DOI: 10.1094/ PDIS-11-15-1300-PDN
Chitambo, O., Haukeland, S., Fiaboe, S.K.M. & Grundler, F.M.W. 2019. African nightshade and African spinach decrease root-knot nematode and potato
cyst nematode soil infestation in Kenya. Plant Disease 103: 1621-1630. DOI: 10.1094/PDIS-07-18-1193-RE CS A (Central Statistical Agency). 2020/21. Agricultural sample survey. Volume I: Report on area and production for major crops (private peasant holdings, main season) Statistical Bulletin 587. Ethiopia, Central Statistical Agency. 133 pp. Demissie, S., Megersa, G., Meressa, B.H. & Muleta, D. 2020. Resistance levels of Ethiopian hot pepper (Capsicum spp.) varieties to a pathogenic Fusarium spp. and in vitro antagonistic effect of Trichoderma spp. Archives of Phytopathology and Plant Protection 54: 647-663. DOI: 10.1080/03235408.2020.1853494 Demmirew, S.K., Edosa, T.T. & Gutema, E.A. 2018. Ecofriendly management of storage insect pests of maize in Jimma Zone. International Journal of Advanced Scientific Research 3: 34-38. Gee, G.W. & Bauder, J. 1986. Particle-size analysis. In: Methods of Soil Analysis. Part 1: Physical and Mineralogical Methods. Agronomy Monograph 9 (A.L. Page Ed.). pp. 383-411. Madison (WI), USA, American Society of Agronomy. Gobie, W. 2019. A seminar review on red pepper (Capsicum) production and marketing in Ethiopia. Cogent Food and Agriculture 5: DOI: 10.1080/ 23311932.2019.1647593 Hooper, D.J., Hallmann, J. & Subbotin, S.A. 2005. Methods of extraction, processing and detection of plant and soil nematodes. In: Plant-Parasitic Nematodes in Subtropical and Tropical Agriculture (M. Luc, R.A. Sikora, & J. Bridge Eds). pp. 53-86. Wallingford, UK, CAB International. DOI: 10.1079/9780851997278.0053 Jackson, M.L. 1967. Soil Chemical Analysis. India,
Prentice-Hall of India Pvt. Ltd. 498 pp. Janssen, T, Karssen, G, Verhaeven, M, Coyne, D. & Bert, W. 2016. Mitochondrial coding genome analysis of tropical root-knot nematodes (Meloidogyne) supports haplotype based diagnostics and reveals evidence of recent reticulate evolution. Scientific Report 6: 1-13. DOI: 10.1038/srep22591 Kamara, C.S., Haque, I. & Soka, A.R. 1992. Soil Physics Manual. Working Document no. B12. Ethiopia, ILCA. 106 pp. Kang, W.-H., Sim, M.Y., Koo, J.N., Nam, J.Y., Lee, J., Kim, N., Jang, H., Kim, Y.-M. & Yeom, S.I. 2020. Transcriptome profiling of abiotic responses to heat, cold, salt, and osmotic stress of Capsicum annuum L. Scientific Data 7: 1-7. DOI: 10.1038/s41597-020-0352-7 Kassie, Y.G. 2019. Status of root-knot nematode (Meloidogyne species) and fusarium wilt (Fusarium oxysporum) disease complex on tomato (Solanum lycopersicum L.) in the Central Rift Valley, Ethiopia. Agricultural Sciences 10: 1090-1103. DOI: 10.4236/as.2019.108082
Kawanobe, M., Sugihara, S., Miyamaru, N., Yoshida, K., Nonomura, E., Oshiro, H. & Toyota, K. 2020. Distribution of root-lesion and stunt nematodes, and their relationship with soil properties and nematode fauna in sugarcane fields in Okinawa, Japan. Agronomy 10: 762. DOI: 10.3390/ agronomy10060762 Kolombia, Y.A., Karssen, G., Viaene, N., Kumar, L.P., De Sutter, N., Joos, L., Coyne, D.L. & Bert, W. 2017. Diversity of root-knot nematodes associated with tubers of yam (Dioscorea spp.) established using isozymes analysis and mitochondrial DNA-based identification. Journal of Nematology 49: 177-188. Trinh, Q.P., Le, T.M.L., Nguyen, T.D., Nguyen, H.T., Liebanas, G. & Nguyen, T.A.D. 2019. Meloidogyne daklakensis n. sp. (Nematoda: Meloidogynidae), a new root-knot nematode associated with Robusta coffee (Coffea canephora Pierre ex A. Froehner) in the Western Highlands, Vietnam. Journal of Helminthology 93: 242-254. DOI: 10.1017/S0022149X18000202 Liu, L., Gu, J., Fang, Y. & Du, Y. 2019. Rapid identification of root knot nematode tropical species by using mitochondrial nad5 gene. URL: https://www.ncbi.nlm.nih.gov/nuccore/MK557 999.1 (accessed: January 2, 2021). Mandefro, W. & Mekete, T. 2002. Root-knot nematodes on vegetable crops in the central and western Ethiopia. Pest Management Journal of Ethiopia 6: 37-44. McSorley, R. 2011. Overview of organic amendments for management of plant-parasitic nematodes, with case studies from Florida. Journal of Nematology 43: 69-81. Meressa, B.H., Dehne, H-W. & Hallmann, J. 2014. Plant-parasitic nematodes associated with commercial cut-flowers in Ethiopia. International Journal of Nematology 24: 1-10. Meressa, B.H., Heuer, H., Dehne H-W. & Hallmann, J. 2015. Molecular and morphological characterisation of Meloidogyne hapla populations from Ethiopia. Russian Journal of Nematology 23: 1-20. Mohammed, B. 2016. Analysis of income and constraints to Chilli pepper production in Kaduna State, Nigeria. Journal of Scientific Research and Reports 9: 1-7. DOI: 10.9734/JSRR/2016/20460 Mokrini, F., Laasli, S.-E. Karra, Y., Aissami, A.E. & Dababat, A.A. 2019. Diversity and incidence of plant-parasitic nematodes associated with saffron (Crocus sativus L.) in Morocco and their relationship with soil physicochemical properties. Nematology 22: 87-102. DOI: 10.1163/15685411-00003286 Noling, J.W. 2003. Citrus nematode. Citrus research and education center (CREC). ENY608 Florida Cooperative Extension Service. URL: https://crec.ifas.ufl.edu/ (accessed: January 5, 2021).
Palomares-Rius, J.E., Castillo, P., Montes-Borrego, M., Navas-Cortés, J.A. & Landa, B.B. 2015. Soil properties and olive cultivar determine the structure and diversity of plant-parasitic nematode communities infesting olive orchards soils in Southern Spain. PLoS ONE 10: e0116890. DOI: 10.1371/ journal.pone.0116890 Parisi, M., Alioto, D. & Tripodi, P. 2020. Overview of biotic stresses in pepper (Capsicum spp.): sources of genetic resistance, molecular breeding and genomics. International Journal of Molecular Sciences 21: 2587. DOI: 10.3390/ijms21072587 Pereira, F., Moreira, C., Fonseca, L., Van Asch, B., Mota, M., Abrantes, I. & Amorim, A. 2013. New insights into the phylogeny and worldwide dispersion of two closely related nematode species, Bursaphelenchus xylophilus and B. mucronatus. PLoS ONE 8: e56288. DOI: 10.1371/journal.pone.0056288 Rashidifard, M., Fourie, H., Marais, M. & Daneel, M. 2019. Characterization of Meloidogyne spp. from South Africa by using NADH5 mtDNA sequences. Scientific Reports 8: 1-9. DOI: 10.1038/ s41598-018-31963-9 Riascos, D.H., Mosquera-Espinosa, A.T., Varón de Agudelo, F. Rosa, J.M.O., Oliveira, C.M.G. & Muñoz, J.E. 2019. Morphological, biochemical, and molecular diagnostics of Meloidogyne spp. associated with Musa spp. in Colombia. Nematropica 49: 229-245. Saleh, B.K., Omer, A. & Teweldemedhin, B. 2018. Medicinal uses and health benefits of chili pepper (Capsicum spp.): a review. MOJFood Processing and Technology 6: 325-328. DOI: 10.15406/mojfpt. 2018.06.00183 Sawadogo, A., Thio, B., Kiemde, S., Drabo, I., Dabire, C., Ouedraogo, J., Mullens, T.R., Ehlers, D. & Roberts, P.A. 2009. Distribution and prevalence of parasitic nematodes of cowpea (Vigna unguiculata) in Burkina Faso. Journal of Nematology 41: 120-127.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S. 2011. MEGA5: Molecular Evolutionary Genetics Analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739. DOI: 10.1093/molbev/msr121 Tefera, T. & Huluka, M. 2000. Distribution of Meloidogyne incognita (root-knot nematode) in some vegetable fields in Eastern Ethiopia. Pest Management Journal of Ethiopia 4: 77-84. Walkey, A. & Black, I.A. 1934. An examination of the Degtjareff method for determining soil organic matter and a proposed modification of the chromic acid titration method. Soil Science 37: 29-30. DOI: 10.1097/00010694-193401000-00003 Westphal, A., Maung, Z., Doll, D., Yaghmour, M.A., Chitambar, J.J. & Subbotin, S.A. 2018. First report
of the peach root-knot nematode, Meloidogyne floridensis infecting almond on root-knot nematode resistant 'Hansen 536' and 'Bright's Hybrid 5' rootstocks in California, USA. Journal of Nematology 51: 1-3. DOI: 10.21307/jofnem-2019-002 World Pepper Market. 2020. Historic Review of 2007-2018 with Projections to 2025. URL: https://www.globenewswire.com/news-release/2020/ 02/05/1980349/0/en/World-Pepper-Market-2020-Historic-Review-of-2007-2018-with-Projections-to-2025 (accessed: June 2, 2021).
YAVUZASLANOGLU, E., ELEKCIOGLU, H.I., NICOL, J.M., Yorgancilar, O., Hodson, D., Yildirim, A.F., YORGANCILAR, A. & BOLAT, N. 2012. Distribution, frequency and occurrence of cereal nematodes on the Central Anatolian Plateau in Turkey and their relationship with soil physicochemical properties. Nematology 14: 839-854. DOI: 10.1163/ 156854112X631926 URL:https://www.nationmaster.com/nmx/ranking/pepper -production-fao (accessed: June 2, 2021).
S.D. Tola, B.H. Meressa, D. Muleta and F. Assefa. Биоразнообразие паразитических нематод, ассоциированных с острым перцем (Capsicum spp.) в районе Джиммы, Эфиопия. Резюме. В последние годы стало ясно, что ущерб перцу заметно возрастает из-за временных и пространственных вариаций нематод, паразитирующих на растениях. Чтобы защитить урожай от этих нематод, необходимо интенсивное обследование и точная идентификация патогенов из сложной тропической и субтропической сельскохозяйственных систем. С этой целью было собрано в общей сложности 105 проб почвы (в 2017 и 2018 гг.) из ризосферы перца в основных районах возделывания перца для выявления нематод. Результаты показали, что 83.3, 87.5, 88.9 и 93.8% полей, обследованных в районах Секору, Керса, Шабе-Сомбо и Омо-Нада в Эфиопии, содержали нематод, которые были идентифицированы в 13 родов, из которых шесть родов часто и в большом количестве обнаруживались в большинстве обследованных районов области, включая Meloidogyne, Scutellonema, Rotylenchulus, Helicotylenchus, Pratylenchus и Rotylenchus. Молекулярный анализ также показал, что все галловые нематоды были Meloidogyne incognita. Корреляционный анализ Пирсона показал, что электропроводность почвы (r2 = 0.914) и содержание песка (r2 = 0.864) имеют сильную положительную корреляцию с плотностью основных паразитических нематод перца, в то время как органическое вещество (r2 = -0,96) демонстрирует сильную отрицательную корреляцию. Поэтому необходимы дальнейшие исследования для оценки уровня ущерба, нанесенного острому перцу, для соответствующих стратегий борьбы с нематодами.
