CC BY
21
FULL COMMUNICATIONS
PLANT SCIENCE
Auxin sensitivity improves production of rosmarinic acid in transformed hairy roots of Lavandula angustifolia
Azadeh Khadem1, Abdolreza Bagheri1, Nasrin Moshtaghi1, Fatemeh Keykha Akhar2, and Ahmad Sharifi3
1Biotechnology and Plant Breeding Department, Faculty of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran
2Department of Plant Biotechnology, Faculty of Agriculture, Jahrom University, Jahrom, Iran 3Department of Ornamental Plant Biotechnology, Academic Center for Education, Culture and Research, Mashhad Branch (Khorasan Razavi Province), Mashhad, Iran
Address correspondence and requests for materials to Abdolreza Bagheri, [email protected]
Abstract
Citation: Khadem, A., Bagheri, A., Moshtaghi, N., Keykha Akhar, F., and Sharifi, A. 2022. Auxin sensitivity improves production of rosmarinic acid in transformed hairy roots of Lavandula angustifolia. Bio. Comm. 67(3): 160-167. https://doi.org/10.21638/spbu03.2022.303
Authors' information: Azadeh Khadem, PhD Student, orcid.org/0000-0001-5612-238X; Abdolreza Bagheri, PhD, Professor, Academic Staff Member, orcid.org/0000-0002-0923-2137; Nasrin Moshtaghi, PhD, Associate Professor, Academic Staff Member, orcid.org/0000-0003-1095-8450; Fatemeh Keykha Akhar, PhD, Assistant Professor, Academic Staff Member, orcid. org/0000-0003-3036-6815; Ahmad Sharifi, PhD, Assistant Professor, Academic Staff Member, orcid.org/0000-0003-0416-1373
Manuscript Editor: Anton Nizhnikov, Department of Genetics and Biotechnology, Faculty of Biology, Saint Petersburg State University, Saint Petersburg, Russia
Received: November 30, 2021;
Revised: March 17, 2022;
Accepted: March 30, 2022.
Copyright: © 2022 Khadem et al. This is an open-access article distributed under the terms of the License Agreement with Saint Petersburg State University, which permits to the authors unrestricted distribution, and self-archiving free of charge.
Funding: No funding information provided.
Ethics statement: This paper does not contain any studies involving human participants or animals performed by any of the authors.
Competing interests: The authors have declared that no competing interests exist.
Hairy root culture is a promising approach to improve production of plant secondary metabolites. The genes, which are located in T-DNA of a root-inducing plasmid, regulate auxin sensitivity of hairy roots. Therefore, this study was aimed to improve the growth and rosmarinic acid production of Lavandula angustifolia hairy roots. Lateral branches of hairy roots were transferred to / MS and / B5 liquid media. To assess auxin sensitivity, indole-3-acetic acid (IAA) and indole-3-butyric acid (IBA) with four different concentrations (0, 0.1, 0.5 and 1 mg/l) were also applied. The growth of hairy roots in / MS medium was twofold higher than in / B5 medium. In addition, both auxins were found to significantly improve the growth of hairy roots whereas non-transformed roots stopped growing in the presence of the auxins. The highest dry weight and rosmarinic acid production of hairy roots were obtained from / MS medium supplemented with IBA irrespective of its concentration. As a result, the hairy roots grown in / MS medium supplemented with IBA produced the maximum amount of rosmarinic acid (7.98 mg/g dry weight of hairy roots). This first report of rosmarinic acid production in L. angustifolia hairy roots provides new insights into the auxin sensitivity of L. angustifolia hairy roots. Keywords: auxin, basal media, hairy roots, rosmarinic acid, TL-DNA
Introduction
Hairy roots are known as a biotechnological approach to improve the production of plant secondary metabolites (Giri and Narasu, 2000). Molecular analysis of Ri plasmid shows that the genes located on T-DNA segment are different between A. rhizogenes agropin and non-agropin strains. Integration of TL-DNA containing rol genes into plant genome is necessary to induce hairy roots, so rol genes are present in Ri plasmid of all A. rhizogenes strains (Veena and Taylor, 2007). A proposed function of rol genes is to improve the sensitivity of hairy roots to auxins. In contrast, TR-DNA is not necessary to induce hairy roots and it is transferred to plant genome independent of TL-DNA integration. aux1 and aux2 genes located in TR-DNA are involved in the pathway of auxin biosynthesis. These findings suggest that auxin has a key role in the growth and other biological processes of hairy roots. Therefore, there is a need to investigate how hairy roots respond to auxin as it has been reported in some medicinal species (Balvanyos, Kursinszki and Szoke, 2001; Liu et al., 2002; Yang et al., 2010).
Rosmarinic acid is a natural antimicrobial and antioxidant agent and the herbs containing it are considered valuable medicinal plants. Biosynthesis and accumulation of this agent are primarily determined by a plant genotype, as it is largely found in Lamiaceae and Boraginaceae plant families (Petersen and Simmonds, 2003).
However, developmental and environmental factors also strongly influence the production of rosmarinic acid in plant tissues (Fletcher, Slimmon, McAuley and Kott, 2005; Manukyan, 2013). Lavender (Lavandula angustifolia) belongs to the Lamiaceae family, and is known to be rich in valuable secondary metabolites. There are some reports concerning the production of rosmarinic acid in cell suspension culture of this plant (Pavlov, Ilieva and Panchev, 2000; Nitzsche, Tokalov, Gutzeit and Ludwig-Muller, 2004). As far as we know, rosmarinic acid production in the hairy root culture of L. angustifolia has not been reported to date. Therefore, this study was conducted to develop the hairy root culture of L. angustifolia and assess the effect of auxin sensitivity of hairy roots on their growth and rosmarinic acid production.
Materials and methods
Plant material
L. angustifolia plants were provided from local markets and the species was confirmed by the Research Center of Plant Sciences, Ferdowsi University of Mashhad. Young leaves and stems were separated and washed under running tap water for 30 min. Surface sterilization was performed by 70 % ethanol for 1 min and then 1 % sodium hypochlorite for 20 min. To remove disinfectants, the leaves were washed three times with sterile distilled water in aseptic conditions. Thereafter, explants were cut into 1 cm pieces and inoculated onto V MS medium for 2 days prior to transformation.
Agrobacterium strains and culture conditions
A. rhizogenes strains K599, MSU-1, R1000, ATCC 15834 and NCPPB 2656 were grown in LB broth medium on a rotary shaker at 28 oC and 120 rpm. Overnight bacterial precultures (OD600 nm = 0.8-1) were collected by centrifugation at 4000xg and then resuspended in the same volume of sucrose 5 % solution containing 100 ^M acetosyringone. After a 2-hour shaking, bacterial suspensions were used for the transformation of explants.
PCR Determination of agropin and non-agropin strains of the bacteria
Bacterial strains were screened by colony PCR using rolC gene specific primers to confirm the presence of Ri plasmid and aux1 gene specific primer to determine ag-ropin and non-agropin strains (Table 1).
Transformation procedure
To improve transformation efficiency, two treatments were performed in the transformation procedure: 1) Leaf and stem segments were dipped in the bacterial suspension.
Table 1. Primers used in PCR analysis of bacterial strains and hairy roots
Primer Name Sequence (5'-3') Size (bp)
rolC F: CTCCTGACATCAAACTCGTC 612
R: TGCTTCGAGTTATGGGTACA
aux1 F: CTCCGATTCCTTTCCAACCG 791
R: CGCACGTTATCCTCATACCC
virD F: CTCATCAGGCACGCTTG 668
R: GCGGATGCTTCAAATGG
Then sonication assisted Agrobacterium rhizogenes transformation (SAArT) was performed at 45 kHz frequency for 10 minutes. Finally, the explants were transferred to V MS solid medium (Murashige and Skoog, 1962) supplemented with 100 acetosyringone without growth regulators. 2) Leaf and stem segments were infiltrated with A. rhizo-genes strains. Then, the infected explants were transferred to V MS solid medium (Murashige and Skoog, 1962) supplemented with 100 acetosyringone and 2 g/L of 40 min-autoclaved glutamic acid into the coculture media. The explants were kept in both light and dark conditions. 3 days after cocultivation, explants were transferred to the same medium supplemented with 400 mg/l cefotaxime sodium. The following subcultures were performed by gradually decreasing the antibiotic concentration until it reached 100-200 mg/l. When the roots reached about 3-4 cm in length, they were cut off and transferred to V MS liquid media and subcultured every two weeks.
Genomic DNA isolation and PCR analysis of T-DNA integration pattern
Plant samples were powdered in liquid nitrogen. Then, genomic DNA of the samples was isolated using DENA-zist plant DNA extraction kit (DENAzist Asia, Mashhad, Iran). PCR analysis of genomic DNA of putative hairy roots, non-transformed roots (negative control) and bacterial R1000 strain (positive control) was performed with rolC gene specific primers to confirm the transformation, and virD gene specific primer to ensure that hairy roots were free of bacterial cells. The transformed clone was further analyzed to determine the presence of TR-DNA in hairy roots using the aux1 primer (Table 1). The PCR products were separated by electrophoresis in a 1 % agarose gel stained with GreenView™.
In vitro auxin treatment of hairy roots and non-transformed roots
The tips of hairy roots and non-transformed roots of in vitro grown plants (3-4 cm) were transferred to V MS medium supplemented with 1 mg/l IAA or IBA. V MS
auxin-free medium was also used as the control treatment. The number of lateral roots and the average root length was determined as the growth pattern of the roots.
Effects of basal media and auxins on the growth of hairy roots
The tips of lateral branches of hairy roots (3-4 cm) were inoculated in ^ MS and ^ B5 (Gamborg, Miller and Ojima, 1968) media containing 3 % sucrose. To assess auxin sensitivity, the media was also supplemented with 0, 0.1, 0.5 and 1 mg/l IAA or IBA. After 3 months of culture, the hairy roots were harvested and kept in a dark place at room temperature until a constant weight was achieved, and then the dry weights were measured. The factorial experiment for growth of hairy roots was conducted in a completely randomized design with three factors (different basal media, different types of auxins and their various concentrations) in three replicates. The data were subjected to analysis of variance (ANOVA) using R agricolae package (Mendiburu, 2017). Significant differences within means were determined by Duncan's multiple range test at 5 % probability.
Rosmarinic acid extraction and HPLC analysis
Dried hairy roots, leaves and roots of naturally grown L. angustifolia plants with three replications were ground into powder and extracted with dichloromethane using a tissue-solvent ratio of 1:10 (w/v). Each sample was sonicated for 7 min at 45 kHz and 80 % amplitude, and then kept for 6h in a dark place at room temperature. The mixture was centrifuged at 4000xg for 10 min, and then the supernatant was separated and evaporated. Afterward, the residue was dissolved in methanol and ZOR-BAX RX-C18 column was used as the stationary phase for HPLC analysis (Agilent 1260, USA).Detection was performed at the wavelength of 280 nm. To determine the rosmarinic acid content of the samples, the peak areas were compared with the peak area of rosmarinic acid authentic standard compound (Sigma-Aldrich) at the respective retention time.
Results and discussion
Determination of bacterial agropin and non-agropin strains
All 5 bacterial strains were verified by the presence of the rolC band with the expected size of 612 bp in their PCR products. Amplification of aux1 gene showed that the bacterial strains were different in the genetic structure of Ri plasmid T-DNA. R1000, MSU-1 and ATCC 15834 strains had the TR-DNA region and grouped into A. rhizogenes
agropin strains, but K599 and NCBPP 2656 strains were grouped as non-agropin strains because they did not have the TR-DNA (Fig. 1a). In previous studies, R1000 and ATCC 15834 strains have been used as agropin strains (Rosic, Momcilovic, Kovacevic and Grubisic, 2006), and K599 and NCBPP 2656 have been introduced as cucu-mopine strains of A. rhizogenes (Haas, Moore, Ream and Manulis, 1995; Weller, Stead and Young, 2006). Among A. rhizogenes strains, agropin types are widely used in plant hairy root induction. The powerful transformation efficiency of these strains in addition to the achievement of high growing hairy roots is attributed to the presence of the TR-DNA region, especially auxin biosynthesis genes (Camilleri and Jouanin, 1991).
Determination of transformation efficiency
The results of this study revealed that different types of explants and light management strongly affect adventitious root formation in lavender, since no adventitious root was induced in light condition. In addition, stem segments did not produce any roots and turned brown one week after cocultivation. In vitro growth of Lavan-dula sp. cells has been shown to be sensitive to light condition and resulted in limited cell differentiation of these species (Goncalves and Romano, 2013).
Among the studied A. rhizogenes strains, K599 with 25 % frequency of adventitious root formation showed the lowest capability to induce roots in leaf explants but the other bacterial strains did not show significant differences, and the frequency of adventitious root induction was about 40-50 % of the total explants (data not shown). Growth evaluation of adventitious roots in liquid culture for two months showed that just one root clone (originated from coculture of a leaf explant with R1000 bacterial strain) developed many lateral branches, so further studies were performed on this hairy root clone.
Sonication of explants using low-frequency ultrasound produces a small wounding in the plant cell wall and improves T-DNA delivery into cells of some plant species (Georgiev, Ludwig-Muller, Alipieva and Lippert, 2011). In addition, monoterpenoids of Lavandula sp. essential oil possess antibacterial properties that may have an inhibitory effect on the growth of bacteria and transformation efficiency. Therefore, glutamic acid derivatives were used in the coculture media as a terpenoid adsorbent with SAArT through the transformation procedure (Sandal et al., 2007). The results showed that none of those treatments had a positive effect on the transformation efficiency. In addition, the adventitious roots did not show morphogenetic properties of hairy roots including a high growth rate and the production of numerous lateral roots. In transformation studies, plant and bacterial genotypes are the most important factors that should be considered. This could be the reason why to date, there is no report on
2 3 4 5 6
OD 1 7 t 3 4 5 6 7 8
Fig. 1. a. Electrophoregram of PCR products of rolC, virD and aux1genes in different samples of plants and bacteria. 1 — 100 bp plus size marker; 2 — A4; 3 — ATCC 15834; 4 — K599; 5 — MSU-1; 6 — NCBPP 2656; 7 — R1000; 8 — Negative control (water). b. PCR analysis of T-DNA integration pattern in the hairy root of L. angustifolia. 1 — 100 bp plus size marker; 2-4 — PCR analysis of rolC gene, 2 — non-transformed root, 3 — R1000 strain of A. rhizogenes, 4 — transformed hairy root; 5-6 — PCR analysis of virD gene, 5 — R1000 strain of A. rhizogenes, 6 — transformed hairy root, 7-8 — PCR analysis of aux1 gene, 7 — R1000 strain of A. rhizogenes, 8 — transformed hairy root.
successful hairy root induction of some valuable medicinal plants such as L. angustifolia.
Molecular analysis of T-DNA integration
To investigate the integration of TL-DNA and TR-DNA, PCR amplification of rolC, auxl and virD genes was performed on the transformed hairy roots. The expected band of the rolC gene was observed in PCR products of the transformed hairy roots and R1000 strain of A. rhi-zogenes but it was not presented in the genomes of the non-transformed roots and deionized water as negative controls. In addition, there was no amplicon of virD gene in PCR product of hairy root whereas this gene existed in Ri plasmid of R1000 strain (Fig. 1b). These results confirmed that TL-DNA was successfully transferred to L. angustifolia cells and the obtained hairy root was free from contamination of A. rhizogenes strains. Moreover, the auxl gene was detected in R1000 strain but it was not transferred to the hairy root genome.
Effects of auxins on the growth of hairy roots and non-transformed roots
The growth pattern of hairy roots and non-transformed roots in auxin-containing media showed significant differences during thirty days of culture. Both IAA and IBA inhibited the growth of non-transformed roots and callus was induced along the root axis whereas hairy roots grew more rapidly than those of auxin-free media and large amounts of lue-pigmented lateral branches were observed (Fig. 2). The pigmentation had gradually decreased 3 weeks after transfer to the liquid media and stopped during successive subcultures. This result was in agreement with previous reports, which concerned the pro-
posed function of rol genes as the regulator of the plant cell growth and differentiation (Blakesley and Chaldecott, 1993). rolB is the central member of root inducing loci and releases IAA from its glucoside conjugate (Estruch, Schell and Spena, 1991). As a result, the N. tabacum rolB-trans-ferred protoplasts have shown 104 fold-hypersensitivity to auxin (Maurel et al., 1991). Therefore, the synergistic effects of rol genes resulted in the improved growth of L. angustifolia hairy roots in response to auxin even though TR-DNA was not presented in the genome of the hairy roots.
Effects of different basal media and auxins on the growth of hairy roots
The effect of different concentrations of IAA and IBA in combination with half-strength MS and B5 basal media on biomass production of hairy roots was evaluated. The average dry mass of hairy roots grown in xh MS medium was two-fold higher than xh B5 medium. In addition, xh B5 medium induced callus formation in hairy roots while it was not observed in xh MS medium (Fig. 3, a-h). Nutrition-dependent growth of hairy roots was also reported in some plant species such as Cucumis melo (Pak et al., 2009), Arachis hypogaea (Condori et al., 2010), and Momordica charantia (Thiruvengadam et al., 2014).
Both types of auxins initially stimulated the growth of hairy roots, but after two months a different trend was noticed in IAA-treated hairy roots as they stopped growing and their color gradually turned dark brown. This phenomenon finally resulted in lower biomass production of IAA-treated hairy roots compared to the auxin-free cultures (Fig. 4, c and f). These results are in agreement with those found by Balvanyos et al. (2001), whose work revealed that the linear growth of Lobelia inflata hairy roots in the IAA-containing medium significantly
Fig. 2. The growth of roots in response to 1 mg/l IBA. a — transformed hairy root; b — non-transformed root.
Fig. 3. Morphological characteristics of treated hairy roots; a-c — lateral view of hairy roots in the growth flasks, d-f — upper view of hairy roots and the inner space of their growth, g-h — macroscopic view of single hairy roots with callus formed along root axis (showed by arrow), a, d, g — Y2 MS medium with 1 mg/l IBA, b, e, h — Y2 B5 medium with 1 mg/l IBA, c, f — Y2 MS medium with 1 mg/l IAA. Scale bar: 0.5 mm.
Fig. 4. Biomass production of hairy roots in response to different basal media and auxin treatments. Different letters indicate significant differences between groups at p<0.05 according to Duncan's multiple range test.
decreased after 27 days. In contrast to the effect of different types of auxins, dry mass of hairy roots was similar in various concentrations of both IAA and IBA (Fig. 4).
Auxins play important roles in many aspects of plant development, but high concentration of auxins stimulates some abnormalities in the fundamental processes of plant cells. For instance, auxin-induced ABA inhibits the growth of both shoots and roots of plants (Hansen and Grossmann, 2000). On the other hand, regulatory mechanisms have also evolved simultaneously with the biosynthesis pathway of endogenous auxins in plants. Previous studies indicate that IBA is the storage form of IAA and acts as an important regulator of
Table 2. Rosmarinic acid content in hairy roots in response to different basal media and various concentrations of IBA
IBA RA* Total RA
(mg/l) (mg/g DW) (mg)
0 2.21 b 0.624
Hairy roots in / MS 0.5 2.84 b 2.790
1 7.98 a 8.363
0 1.86 bc 0.416
Hairy roots in / B5 0.5 0.89 c 0.506
1 0.58 c 0.232
leaves 10.2 a
normal roots 1.94 bc
* Different letters indicate significant differences between groups at p<0.05 according to Duncan's multiple range test. RA: Rosmarinic acid, Total RA: RAxDW.
auxins, especially for IAA derivatives in a peroxisome-dependent manner (Ludwig-Muller, 2000; Simon and Petrasek, 2011). Therefore, it is reasonable to propose that the presence of IAA in a long-term hairy root culture probably disrupts IAA/IBA homeostasis and directly induces some plant inhibitory mechanisms in hairy roots of L. angustifolia.
Effects of basal media and auxins on rosmarinic acid production of hairy roots
According to the results obtained from the growth assessment of hairy roots, the chromatographic analysis was not performed on IAA-treated cultures. Therefore, six treatments of hairy roots (two basal media in combination with three concentrations of IBA), non-transformed roots and leaves of naturally grown lavender were assayed for the content of rosmarinic acid. The results showed that the production of rosmarinic acid in the absence of IBA was not affected by different types of basal media, but interestingly, the interaction of basal media and various concentrations of IBA significantly affected the rosmarinic acid content in hairy roots. A slight decrease in the production of rosmarinic acid was observed upon increasing the concentration of IBA in / B5 medium, however, it was not significant, but the elevated levels of IBA greatly improved the biosynthesis of rosmarinic acid in / MS-cultured hairy roots. As a result, rosmarinic acid content in those hairy roots was approximately 3.5-fold higher than that of hairy roots grown in / MS media without any auxins (Table 2). Similar results were also reported in the hairy root culture of Nepeta cataria, where the production of rosmarinic acid
in the presence of IBA was 1.5-fold higher compared to the control (Yang et al., 2010). HPLC analysis also revealed that the roots of naturally grown plants have low amount of rosmarinic acid. This indicates that the type of tissue is a determinant of rosmarinic acid production, but the best results could also be achieved by the manipulation with environmental conditions as well as with genetic background. Previous studies also showed the increased growth of hairy roots of different species such as Scutellaria lateriflora and Rauvolfia micrantha in response to IBA application, but the growth of hairy roots in these studies has been tripled at most compared to the control treatment. In this study, the total amount of RA in the presence of 1 mg/L1 IBA was increased 13.4-fold higher than control (without any auxins). In conclusion, it seems possible to obtain a high yield of rosmarinic acid production from hairy root cultures using the advantages of in vitro conditions together with promising characteristics of hairy roots such as auxin hypersensitivity.
References
Balvanyos, I., Kursinszki, L., and Szoke, E. 2001. The effect of plant growth regulators on biomass formation and lobeline production of Lobelia inflata L.hairy root cultures. Plant Growth Regulation 34:339-345. https://doi. org/10.1023/A:1013374524757 Blakesley, D. and Chaldecott, M.A. 1993. The role of endogenous auxin in root initiation. Plant Growth Regulation 13:77-84. https://doi.org/10.1007/BF00024593 Camilleri, C. and Jouanin, L. 1991. The TR-DNA region carrying the auxin synthesis genes of the Agrobacterium rhizogenes agropine-type plasmid pRiA4: nucleotide sequence analysis and introduction into tobacco plants. Molecular Plant-Microbe Interactions 4:155-162. https:// doi.org/10.1094/mpmi-4-155 Condori, J., Sivakumar, G., Hubstenberger, J., Dolan, M.C., Sobolev, V.S., and Medina-Bolivar, F. 2010. Induced biosynthesis of resveratrol and the prenylated stilben-oids arachidin-1 and arachidin-3 in hairy root cultures of peanut: Effects of culture medium and growth stage. Plant Physiology and Biochemistry 48:310-318. https:// doi.org/10.1016/j.plaphy.2010.01.008 Estruch, J.J., Schell, J., and Spena, A. 1991. The protein encoded by the rolB plant oncogene hydrolyses indole gluco-sides. The EMBO Journal 10(11):3125-3128. https://doi. org/10.1002/j.1460-2075.1991.tb04873.x Fletcher, R. S., Slimmon, T., McAuley, C. Y., and Kott, L. S. 2005. Heat stress reduces the accumulation of rosmarinic acid and the total antioxidant capacity in spearmint (Mentha spicata L). Journal of the Science of Food and Agriculture 85:2429-2436. https://doi.org/10.1002/jsfa.2270 Gamborg, O.L., Miller, R., and Ojima, K. 1968. Nutrient requirements of suspension cultures of soybean root cells. Experimental Cell Research 50:151-158. https://doi. org/10.1016/0014-4827(68)90403-5 Georgiev, M. I., Ludwig-Muller, J., Alipieva, K., and Lippert, A. 2011. Sonication-assisted Agrobacterium rhizogenes-me-diated transformation of Verbascum xanthophoeniceum Griseb. for bioactive metabolite accumulation. Plant Cell Reports 30:859-866. https://doi.org/10.1007/s00299-010-0981-y
Giri, A. and Narasu, M. L. 2000. Transgenic hairy roots: recent trends and applications. Biotechnology Advances 18:1-22. https://doi.org/10.1016/S0734-9750(99)00016-6 Gongalves, S. and Romano, A. 2013. In vitro culture of lavenders (Lavandula spp.) and the production of secondary metabolites. Biotechnology Advances 31:166-174. https:// doi.org/10.1016/j.biotechadv.2012.09.006 Haas, J. H., Moore, L.W., Ream, W., and Manulis, S. 1995. Universal PCR primers for detection of phytopathogenic Agrobacterium strains. Applied and Environmental Microbiology 61:2879-2884. https://doi.org/10.1128/AEM. 61.8.2879-2884.1995 Hansen, H. and Grossmann, K. 2000. Auxin-induced ethylene triggers abscisic acid biosynthesis and growth inhibition. Plant Physiology 124:1437-1448. https://doi.org/10.1104/ pp.124.3.1437
Liu, C., Zhu, J., Liu, Z., Li, L., Pan, R., and Jin, L. 2002. Exogenous auxin effects on growth and phenotype of normal and hairy roots of Pueraria lobata (Willd.) Ohwi. Plant Growth Regulation 38:37-43. https://doi. org/10.1023/A:1020904528045 Ludwig-Muller, J. 2000. Indole-3-butyric acid in plant growth and development. Plant Growth Regulation 32:219-230. https://doi.org/10.1023/A:1010746806891 Manukyan, A. 2013. Effects of PAR and UV-B radiation on herbal yield, bioactive compounds and their antioxidant capacity of some medicinal plants under controlled environmental conditions. Photochemistry and Pho-tobiology 89:406-414. https://doi.org/10.1111Zj.1751-1097.2012.01242.x Maurel, C., Barbier-Brygoo, H., Spena, A., Tempe, J., and Guern, J. 1991. Single rol genes from the Agrobacterium rhizogenes TL-DNA alter some of the cellular responses to auxin in Nicotiana tabacum. Plant Physiology 97:212216. https://doi.org/10.1104/pp.97.1.212 Mendiburu, F. 2017. Agricolae: Statistical procedures for agricultural research. R package version 1.2-8. R Foundation for Statistical Computing, Vienna, Austria. Nitzsche, A., Tokalov, S.V., Gutzeit, H.O., and Ludwig-Muller, J. 2004. Chemical and biological characterization of cin-namic acid derivatives from cell cultures of lavender (La-vandula officinalis) induced by stress and jasmonic acid. Journal of Agricultural and Food Chemistry 52:2915-2923. https://doi.org/10.1021/jf030747j Pak, H. K., Sim, J. S., Rhee, Y., Ko, H. R., Ha, S. H., Yoon, M. S., Kang, C.H., Lee, S., Kim, Y.H., and Hahn, B.S. 2009. Hairy root induction in Oriental melon (Cucumis melo) by Agrobacterium rhizogenes and reproduction of the root-knot nematode (Meloidogyne incognita). Plant Cell, Tissue and Organ Culture 98:219-228. https://doi.org/10.1007/ s1 1240-009-9556-4 Pavlov, A. I., Ilieva, M. P., and Panchev, I. N. 2000. Nutrient medium optimization for rosmarinic acid production by Lavandula vera MM cell suspension. Biotechnology Progress 16:668-670. https://doi.org/10.1021/bp000041z Petersen, M. and Simmonds, M. S. 2003. Rosmarinic acid. Phy-tochemistry 62:121-125. https://doi.org/10.1016/S0031-9422(02)00513-7 Rosic, N., Momcilovic, I., Kovacevic, N., and Grubisic, D. 2006. Genetic transformation of Rhamnus fallax and hairy roots as a source of anthraquinones. Biologia Plantarum 50:514-518. https://doi.org/10.1007/s10535-006-0081-6 Sandal, I., Saini, U., Lacroix, B., Bhattacharya, A., Ahuja, P. S., and Citovsky, V. 2007. Agrobacterium-mediated genetic transformation of tea leaf explants: effects of counteracting bactericidity of leaf polyphenols without loss of bacterial virulence. Plant Cell Reports 26:169-176. https:// doi.org/10.1007/s00299-006-021 1-9
Simon, S. and Petrasek, J. 2011 Why plants need more than one type of auxin. Plant Science 180:454-460. https://doi. org/10.1016/j.plantsci.2010.12.007 Thiruvengadam, M., Praveen, N., John, K.M., Yang, Y.S., Kim, S. H., and Chung, I. M. 2014. Establishment of Mo-mordica charantia hairy root cultures for the production of phenolic compounds and determination of their biological activities. Plant Cell, Tissue and Organ Culture 118:545-557. https://doi.org/10.1007/s11240-014-0506-4
Veena, V. and Taylor, C.G. 2007. Agrobacterium rhizogenes: recent developments and promising applications. In Vi-
tro Cellular & Developmental Biology — Plant 43:383-403. https://doi.org/10.1007/s11627-007-9096-8 Weller, S. A., Stead, D. E., and Young, J. P. W. 2006. Recurrent outbreaks of root mat in cucumber and tomato are associated with a monomorphic, cucumopine, Ri-plasmid harboured by various Alphaproteobacteria. FEMS Microbiology Letters 258:136-143. https://doi.org/10.1111/ j.1574-6968.2006.00214.x Yang, Y.K., Lee, S.Y., Park, W.T., Park, N.I., and Park, S.U. 2010. Exogenous auxins and polyamines enhance growth and rosmarinic acid production in hairy root cultures of Nepeta cataria L. Plant Omics 3:190-193.
