CC BY
22
8. Khamraev A. S., Lebedeva N. I., Zhuginisov T. I. et all. - 2007. Food preferences of the turkestan termite Anacanthotermes turkestanicus (Isoptera: Hodotermitidae). USA, Sociobiology, - Vol. 50, - No. 2. - 469-478.
9. Khamraev A.Sh., Lebedeva N. I., Khokhlacheva V. E., et al, - 2008. Anacanthotermes termites - dangerous bio-destroyer of Uzbekistan facilities and elaboration of preventive methods and actions to control their population. (Collected works) Use of best practices to protect plants against pests", - Tashkent: TALQIN, - 102-114.
10. Khamraev A.Sh., Lebedeva N. I., Mirzaeva G. S., et al, - 2013. Biological and ecological features of common beetle (Anobium pertinax L.). Information bulletin of the Karakalpak State University named after Berdakh, Nukus, - No 3. - 143-147.
11. Khamraev A.Sh., Lebedeva N. I., Mirzaeva G. S., et al, - 2015. Wood as the habitat for borers. Reports of the AS of RUz, - No 2. - 93-97.
12. Lebedeva N. I., Khamraev A.Sh. - 2014. Common furniture beetle (Anobium pertinax L.) - enemy of wooden structures. Materials of the applied science conference "Improvement of measures against termits within the country territory", - Tashkent, - April 11, -2014. - P. 27-30.
13. Lebedeva N. I., Khamraev A.Sh., Akhmedova Z.Yu., 2014 a. Xylophagous insects - malicious infestants of wooden materials and historic monuments. Materials of the applied science conference "Improvement of measures against termits within the country territory", -Tashkent, - April 11, - 2014. - P. 21-27.
14. Lebedeva N. I., Khamraev A.Sh., Mirzaeva G. S., et al, - 2014 b. Xylophagous insects - pest to destroy wooden materials and historic monuments. Information bulletin of the Karakalpak State University named after Berdakh, Nukus, - 4 (25): 21-25.
15. Luppova A. N., - 1958. Termites of Turkmenistan. Research works of the Zoology and Parasitology Institute, Academy of Sciences of - Turkmen SSR, - T. 2. - 81-145.
16. Mamaev B. M., Medvedev L. N., Pravdin F. N., - 1976. Insect identifier in the European part of the USSR. - M.: Prosveshenie: - 103-187.
17. Mirzaeva G. S., Allaberdiev R.Kh., Khamraev A.Sh. et all. - 2012. Molecular genetic studies of termites Anacanthotermes kind in Central Asia. 3rd International Conference "Molecular phylogenetics MolPhy-3", M. V. Lomonosov Moscow State University. - Moscow, - July 31 - August 4, - 2012 - M.: - 127.
18. Mozolevskaya E. G., Selikhovkin A. V., Izhevsky S. S., et al, - 2010. Forest Entomology. A textbook for university students. - M.: Aka-demiya, - 1-416.
19. Nurzhanov F. A., Lebedeva N. I., Nurzhanov A. A. - 2013. Determination of wood resistant to xylophagous insect damage and reasons of their stability. Biology - science of XXI century. - 17 International Pushin School of young scholars, SPb, thesis - M.: - 549-550.
20. Pearce M. J. - 2000. Termites. Biology, ecology and control: - 1-115.
21. Toskina I. N., Provorova I. P., - 2007. Museum insects. (Biology. Infestation prevention. Measures). - M.: Partnership of scientific publications, KMK: - 58-67.
22. Ergashev N. E., Madatyan A. V., Lebedeva N. I., - 1996. Injurious activity of termites in residential buildings. Agriculture of Uzbekistan, - Tashkent, - No 2. - 42.
23. Yakobson G. G., - 1904. On Russian termites. Works of the Entomology Bureau of the Board of Scholars of the Main department for land management and agriculture. - M., - T. YIII, - No 4. - 3-54.
24. Yakobson G. G., - 1913. Termites, inhabitant, damage caused by termites and ways of liquidation Works of the Entomology Bureau of the Board of Scholars of the Main department for land management and agriculture. - M., - T. X, - No 2. - 3-76.
DOI: http://dx.doi.org/10.20534/ESR-16-11.12-8-12
Mirzaakhmedova Nargiz Alisultanova, Dalimova Dilbar Akbarovna, Tashkent institute of improvement of doctors, Tashkent, Uzbekistan Laboratory of Genomics, Institute of Bioorganic Chemistry, Academy of Sciences of the Republic of Uzbekistan E-mail: nargis-doc@mail.ru
Association of polymorphisms of ADIPOQ, APOA5 and APOC3 genes with menopausal metabolic syndrome in Uzbek population of women
Abstract: Menopausal metabolic syndrome (MMS) — is a set of neurovegetative, psychoemotional and exchange-endocrine disorders occurring with the onset of menopause and include rapid weight gain with the formation of abdominal obesity, insulin resistance and dyslipidemia and/or arterial hypertension.
Each of the key components of MS, such as obesity, dyslipidemia, hyperglycemia and high blood pressure, has genetic predisposition for which main candidate genes were identified. These candidate genes areADIPOQ, APOA5 and APOC3.
It should be noted that certain gene polymorphisms in combination with estrogen deficiency displaythemselves differently in different populations dependent on gender, age and ethnicity.
The aim of our study was to investigate the association of polymorphisms of ADIPOQ, APOA5 and APOC3 genes in the Uzbek population of women with menopausal metabolic syndrome.
Association of polymorphisms of ADIPOQ, APOA5 and APOC3 genes with menopausal metabolic syndrome.
Materials and methods 60 women were involved in the study, with surgical and physiological menopause with the menopausal metabolic syndrome diagnosis (MMS). Genotyping of polymorphisms of ADIPOQ, APOA5 and APOC3 genes performed by PCR-RFLP.
Conclusion: the results obtained in this study suggest that the genetic variants of adiponectin gene (ADIPOQ) and apo-lipoprotein apoA5 gene (APOA5) labeled as the +276 (G/T) and -1131T>C contribute to the determination of violations which at the final stage lead to the development of MMC. In particular, G allele of ADIPOQgene (genotype G/G and G/T) and genotype C/C of ApoA5 gene are genetic markers of predisposition to the MMC in Uzbek population ofwomen. It is possible to do stratification of menopausal women into risk groups with the use of these markers.Application of the genetic markers in molecular-genetic prediction of MMC have great advantage as far as the predisposition to the disease may be established in the absence of any clinical or biochemical symptoms, i. e. at a very early stages of preclinical development of pathology. This will facilitate in targeted preventive measures and improvement of the quality of life of these patients.
Keywords: metabolic syndrome, arterial hypertension, hyperinsulinemia, abdominal obesity.
Menopausal metabolic syndrome (MMS) — is a set of neurovegetative, psychoemotional and exchange-endocrine disorders occurring with the onset of menopause and include rapid weight gain with the formation of abdominal obesity, insulin resistance and dyslipidemia and/or arterial hypertension.
Based on a detailed analysis of the work on the impact of menopause on insulin sensitivity, lipid and carbohydrate metabolism, distribution of adipose tissue and hemostasis system, as well as data on the effect of hormone therapy on these parameters in women, it is proposed to allocate the MMS as a complex of pathogenic risk factors of cardiovascular diseases, and ischemic heart disease in the first place, which is based on estrogen deficiency and insulin resistance.
Until now, the causes of MS in postmenopausal women, where complex interaction of genetic and environmental (in this case estrogen deficiency) factors plays a big role are not precisely known. In recent years, researchers started to pay more attention to the study of molecular-genetic factors of MS, to the scanning for susceptibility genes and polymorphisms and to the analysis of their association with various components of the syndrome. The role of genetic factors in the development of MS confirmed by some ethnic peculiarities of predisposition to MS. There are some reports about the association of MS with polymorphisms of several genes which products control adipogenesis, inflammation, carbohydrate and lipid metabolism. It is known that genes may influence the development of MS in various ways. Each of the key components of MS such as obesity, dyslipidemia, hyperglycemia and high blood pressure has a genetic predisposition and the main candidate genes has already been identified. This predisposition may cause or accelerate the development of MS. The main candidate genes are ADIPOQ, APOA5 and APOC3.
The ADIPOQis one of the key genes which plays an important role in the development of metabolic syndrome. This gene composes of 3 exons and 2 introns, locates in the 3q27 locus of 3rd chromosome and expresses in the adipose tissue [1; 2]. Its product, the hormone adiponectin, consists of247 amino acids [3], has antiinflammatory and anti-sclerotic effect, increases sensitivity to insulin, regulates ^-oxidation of fatty acids and maintains the glucose level in skeletal muscles and liver [4].
Gene APOA5, which encoding a protein of human apoA5, is localized in chromosome 11 and is located in a cluster of apolipopro-teins apoA1/apoS3/apoA4/apoA5 and has 4 exons. APOA5 polymorphism associates with the level of triglycerides [5].
Apolipoprotein C-3 is another important apolipoprotein. Apo-lipoprotein C-3 is one of the basic components of triglyceride-rich lipoproteins (chylomicron and very low density lipoproteins), and is a part of high-density lipoproteins. It contains 79 amino acid resi-
dues and has a molecular weight of 8764 kDa. The apolipoprotein C-3 gene (APOC-3) is localized in chromosome 11q23.3 and in the gene cluster APOA-1 and APOA-4 within the range of 15 kb. It is expresses mainly in the liver cells [6].
It should be noted that the polymorphisms of certain genes in combination with the estrogen deficiency reveal themselves differently in different populations dependent on gender, age and ethnicity of their carriers. This indicates that the results obtained in one ethnic group should be carefully compared with the other populations.
The aim of our study was to investigate the association of polymorphisms of ADIPOQ, APOA5 and APOC3 genes in the Uzbek population of women with menopausal metabolic syndrome.
Materials and methods
In the study took part 60 women with surgical and physiological menopause with the diagnosis menopausal metabolic syndrome (MMS). In the control group there were randomly chosen 31 almost healthy women ofmenopausal period without any signs ofMS. The age, gender and ethnical background were the same for experimental and control groups.
MMS diagnosis was confirmed based on the criteria of the International Diabetes Federation (2005).
All patients gave informed consent for this study. The research was carried out according to ethical standards of the National Ethics Committee of Uzbekistan, developed in accordance with the Helsinki Declaration of the World Medical Association's "Ethical Principles for medical research involving human subjects", with amendments (2013).
Genomic DNA was isolated from peripheral blood lymphocytes by standard protocol using a kit — Diatom™ DNA Prep 200 (production of "ISOGEN laboratory"). The action of this kit is based on the use of guanidine thiocyanate lysis agent that is intended to disrupt the cells, solubilization of cell debris and denaturation of cellular nucleases. In the presence oflysis agent DNA was sorbed on the NucleoS™ (sorbent), then washed of salts and proteins with an ethanol solution. DNA, eluted from the Extra-Genome™ sorbent was directly used for further analysis.
Genotyping of polymorphisms of ADIPOQ, APOA5 and APOC3 genes performed by PCR-RFLP.
At the first stage amplification of gene fragments was performed by PCR GeneAmp 9700 thermocycler (Applied Biosystems) with the use of flanking primers (Table 1). Each mixture for PCR reaction (total volume 15 yl) contained 5.2 yl of ddH2O, 2.5 yl of 10xPCR buffer, 1.5 yl of 25 mM MgCl2, 1.5 yl of 2.5 mM dNTP mixture (dATP, dCTP, dGTP, dTTP), 1.5 yl (10 pmol/yl) of each oligonucleotide primer, 0.3 yl (1.5 units.) of Taq-polymerase and 2 yl of DNA. PCR conditions are given in Table 2.
Table 1. - Oligonucleotide primers used in this work
Gene and Polymorphism Primer Sequence of primer
ADIPOQ+276 (G/T) Pr_ADIPOQ_F TCTCTCCATGGCTGACAGTG
Pr_ADIPOQ_R AGATG CAG CAAAG C CAAAGT
APOA5 Pr APOA5 F CAAGGTGACAGACAACTGGTGCAATGAT
- 1131T>C Pr APOA5 R CCCCAGGAACTGGAGCGAAATT
APOC3 Pr_ APOC3_F G GATTGAAACCCAGAGATG GAG GTG
-455T>C Pr_ APOC3_R TTCACACTG GAATTTCAGGCC
Table 2. - Amplification mode
Gene and Polymorphism Temperature Time Number of cycles
94 °C 5 min 1
94 °C 30 sec
ADIPOQ+276 (G/T) 57 °C 30 sec 35
72 °C 30 sec
72 °C 5 min 1
95 °C 5 min 1
APOA5 -1131T>C 95 °C 30 sec
64 °C 45 sec 35
72 °C 45 sec
72 °C 3 min 1
95 °C 5 min 1
APOC3 -455T>C 95 °C 30 sec
60 °C 30 sec 35
72 °C 45 sec
72 °C 5 min 1
Products of PCR — gene fragments ADIPOQ, APOA5 iAPOC3 subjected to restriction via PctI, Tru9I and Fokl endonucle-ases, respectively. The resulting restriction products were separated by gel electrophoresis in 8% polyacrylamide gel followed by staining with ethidium bromide and visualized in the transmitted ultraviolet light using a transilluminator «WiseDoc WGD-30» (DAIHAN, South Korea). Results of genotyping were analyzed on the basis of the differential pattern of bands on electrophoregram.
Statistical analysis
Assessment of genotype distribution frequency of Hardy-Weinberg equilibrium was performed using x2 test (Pearson's chi-squared test) (with p> 0.05). Assessment of the differences of frequency of alleles and genotypes of polymorphisms of PNPLA3 and AdipoQ genes between patients with MMS and control group was performed using Pearson's x2 test with the use of several models of inheritance. The differences accepted as significant at p <0.05. To describe the
relative risk of disease progression the odds ratio (OR) was used. OR = 1, considered as a lack of association, OR> 1 — as a positive association (increased risk of disease), OR <1 — as a negative association of the allele or genotype with the disease (reduced risk of disease). Calculations were performed using the "statistics Calculator for the studies" case-control" [7].
Results and discussion.
The frequency distribution of genotypes of ADIPOQ, APOA5 APOC3 genes in the control group was in line with the distribution of Hardy-Weinberg. Comparative analysis of the genotypes distribution frequency ofpolymorphism +276 (G/T) ofAdi-poQgene showed statistically significant (p = 0.002 for the general model of inheritance and 0.0004 for the additive model of inheritance) increase in the occurrence of monozygotic G/G and heterozygous G/T in the experimental group compared with those in the control group (Fig. 1, tab. 3).
Figure 1. The distribution of genotype frequencies of the polymorphism +276 (G/T) of AdipoQ gene in the control and experimental groups
Association of polymorphisms of ADIPOQ, APOA5 and APOC3 genes with menopausal metabolic syndrome...
Table 3. - The results of the statistical analysis of genetic association of genotypes of AdipoQ gene with MMS
Model of inheritance Genotypes cases Controls x2 P OR
n = 49 n = 31 value 95% CI
General inheritance model (chi-square test, df = 2) G/G 16.3% 6.5% 16.70 0.0002 2.83 0.56-14.31
G/T 53.1% 16.1% 5.88 1.94-17.83
T/T 30.6% 77.4% 0.13 0.05-0.36
The additive model of inheritance (Cochran-Armitage test for linear trends, xi = [0, 1, 2], df = 1) G/G 16.3% 6.5% 12.68 0.0004 2.83 0.56-14.31
G/T 53.1% 16.1% 5.88 1.94-17.83
T/T 30.6% 77.4% 0.13 0.05-0.36
The dominant model of inheritance (Chi-square test, df = 1) G/G+ G/T 0.694 0.226 16.65 >0.0001 7.77 2.75-21.95
T/T 0.306 0.774 0.13 0.05-0.36
The distribution of variant genotypes polymorphism ditive model of inheritance, p = 0.001 for the recessive model ofin--1131T>C ApoA5 gene analysis showed statistically significant (p heritance) increase in the occurrence of monozygotic C/C patients = 0.004 for the general model of inheritance, p = 0.005 for the ad- (35.1%) compared with that in the control group (3.3%).
Figure 2. The distribution of genotype frequencies of the polymorphism -1131T>C of ApoA5 gene in the control and experimental groups
Table 4. - The results of the statistical analysis of genetic association of genotypes of ApoA5 gene with MMS
Model of inheritance Genotypes cases Controls x2 P OR
n = 57 n = 30 value 95% CI
General inheritance model (chi-square test, df = 2) T/T 22.8% 36.7% 10.88 0.004 0.51 0.19-1.34
T/C 42.1% 60% 0.48 0.20-1.19
C/C 35.1% 3.3% 15.68 1.99-123.78
The additive model of inheritance (Cochran-Armitage test for linear trends, xi = [0, 1, 2], df = 1) T/T 22.8% 36.7% 7.92 0.005 0.51 0.19-1.34
T/C 42.1% 60% 0.48 0.20-1.19
C/C 35.1% 3.3% 15.68 1.99-123.78
The recessive model of inheritance (Chi-square test, df = 1) T/T+T/C 0.649 0.967 10.82 0.001 0.06 0.01 -0.50
C/C 0.351 0.033 15.68 1.99-123.78
Comparative analysis of the genotypes distribution frequency ofpolymorphism -455T> C ofAPOC3 gene showed no statistically significant differences between experimental and control groups (Table 5, Figure 3).
Thus, the results obtained in this study suggest that the genetic variants of adiponectin gene (ADIPOQ) and apolipoprotein apoA5 (APOA5) labeled as the +276 (G/T) and -1131T>C contribute to the determination of violations which at the final stage lead to the development of MMC. In particular, G allele ofADIPOQ
gene (genotype G/G and G/T) and genotype C/C ofApoA5 gene are genetic markers of predisposition to the MMC in Uzbek population of women. It is possible to do stratification of menopausal women into risk groups with the use of these markers. Application of the genetic markers in molecular-genetic prediction of MMC have great advantage as far as the predisposition to the disease may be established in the absence of any clinical or biochemical symptoms, i. e. at a very early stages of preclinical development of pathology. This will facilitate in targeted preventive measures and improvement
of the quality of life of these patients which will reduce the risk of timely hormone replacement therapy, taking into account the pre-the development of cardiovascular disease. Preventive measures disposition to carbohydrate disorders and obesity. would include monitoring and correction of lipid profile, triglycer- Therefore, it seems appropriate to include polymorphisms testides for the prevention of atherosclerosis; abdominal obesity, insulin ing (+276 (G/T) of ADIPOQgene and -1131T> of CAPOA5 gene) resistance, hypertension, BMI correction (body mass index) and in a comprehensive program of MMS prevention in Uzbekistan.
Figure 3. The distribution of genotype frequencies of the polymorphism 455T>C of APOC3 gene in the control and experimental groups
Table 5. - The results of the statistical analysis of genetic association of genotypes of ApoC3 gene with MMS
Model of inheritance Genotypes cases Controls x2 P OR
n = 60 n =31 Value 95% CI
General inheritance model (chi-square test, df = 2) Т/Т 0.383 0.226 2.30 0.32 2.13 0.79-5.73
Т/С 0.467 0.581 0.63 0.26-1.52
С/С 0.150 0.194 0.74 0.24-2.30
The additive model of inheritance (Cochran-Armitage test for linear trends, xi = [0,1,2], df = 1) Т/Т 0.383 0.226 1.77 0.18 2.13 0.79-5.73
Т/С 0.467 0.581 0.63 0.26-1.52
С/С 0.150 0.194 0.74 0.24-2.30
The dominant model of inheritance (Chi-square test, df = 1) Т/Т+Т/С 0.850 0.806 0.28 0.6 1.36 0.44-4.25
С/С 0.150 0.194 0.74 0.24-2.30
The recessive model of inheritance (Chi-square test, df = 1) Т/Т 0.383 0.226 2.30 0.13 2.13 0.79-5.73
Т/С+С/С 0.617 0.774 0.47 0.17-1.26
References:
1. GenBank: URL: http://www.ncbi.nlm.nih.gov. GenBank is the NIH genetic sequence database, an annotated collection of all publicity available DNA sequences.
2. Yang W. S., Tsou P. L., Lee W. J. et.al. Allele-specific differential expression of a common adiponectin gene polymorphism related to obesity//J Mol Med - 2003, - 81:428-434).
3. Sun Y., Xun K., Wang C. et. al. Adiponectin, an unlocking adipocytokine//Cardiovasc Ther. - 2009. - Vol. 27, - No 1. - P. 59-75.
4. Fumeron F., Aubert R., Siddiq A., Betoulle D., Pean F., Hadjadj S., Tichet J., Wilpart E., Chesnier M.-C., Balkau B., Froguel P., Marre M. Adiponectin gene polymorphisms and adiponectin levels are independently associatedwith the development of hyperglycemia during a 3-year period//Diabetes. - 2004. - Vol. 53. - P. 1150-1157.
5. Pennacchio LA1, Rubin EM. Apolipoprotein A5, a newly identified gene that affects plasma triglyceride levels in humans and mice. Arterioscler Thromb Vasc Biol. - 2003. - Apr 1. - 23 (4). - 529-34.
6. Talmud P. J., Humphries S. E. Apolipoprotein C-III genevariation anddyslipidaemia//Curr. Opin. Lipidol. - 1997. - Р. 154-158.
7. Калькулятор для расчета статистики в исследованиях «случай-контроль» [http://gen-expert.ru/calculator_or.php].
