CC BY
77
ANALYSIS OF THE ASSOCIATION BETWEEN THE RS767455 T>C TNFRSF1A AND RS1061622 T>G TNFRSF1B POLYMORPHISMS AND NONALCOHOLIC STEATOHEPATITIS
Topchieva LV1 Kurbatova IV1, Dudanova OP2, Shipovskaya AA2
1 Institute of Biology, Karelian Research Center of RAS, Petrozavodsk, Republic of Karelia
2 Institute of Medicine, Petrozavodsk State University, Petrozavodsk, Republic of Karelia
Poor diet, sedentary behavior and genetic background are major factors contributing to the etiology and pathogenesis of non-alcoholic fatty liver disease (NAFLD). It is hypothesized that polymorphisms of the TNFRI and TNFRII genes coding for the receptors that bind the proinflammatory cytokine tumor necrosis factor alpha (TNFa) can be implicated in the susceptibility to NAFLD, but not much data is available in the literature. In the present work we aimed to investigate a possible association between the rs767455 T>C TNFRSF1A and rs1061622 T>G TNFRSF1B polymorphisms and one of NAFLD forms, nonalcoholic steatohepatitis (NASH), and to assess their effect on blood biochemistry. Samples of DNA isolated from the venous blood of 151 healthy donors and 242 patients with NASH were genotyped using PCR-RFLP. TNFa concentrations were measured by ELISA. We have not found any association between the rs767455 T>C TNFRSF1A polymorphism and the development of NASH in the residents of Karelia. However, we have discovered an association between NASH and the T>G TNFRSF1B rs1061622 polymorphism. Carriers of the G allele have a higher risk of developing NASH (OR = 4.83; 95% CI: 2.72-8.57). The rs1061622 T>G genotype of the TNFRSF1B gene appears to have no effect on TNFa concentrations and the activity of alanine aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP). Our findings suggest a possible association between the rs1061622 T>G TNFRSF1B polymorphism and a risk of developing NASH in the residents of Karelia.
Keywords: non-alcoholic steatohepatitis, tumor necrosis factor alpha, tumor necrosis factor alpha receptors, mbTNFRI, sTNFR, TNFRSF1A gene, TNFRSF1B gene, gene polymorphism, alanine aminotransferase, aspartate aminotransferase
Funding: this study was part of the public contract 0221-2017-0049 and was carried out using the equipment of the shared facility Complex Basic and Applied Research of Living Systems in the Arctic of the Institute of Biology, Karelian Research Center. The work was also sponsored by a scholarship of the President of the Russian Federation for young scientists and graduate students engaged in advanced research and development in priority areas of modernization of the Russian economy in 2015-2017 years. The authors also received support from Petrozavodsk State University as part of the efforts for its strategic development in 20132017 (R&D 115070110006, Information reference map 216022450003, registered February 24, 2016) under the project for the Development of Technologies for Diagnostic Screening for Nonalcoholic Fatty Liver Disease in Overweight Patients and Patients with Metabolic Syndrome (ID 9173GU/2015 dated December 15, 2015) of the UMNIK program.
gg Correspondence should be addressed: Ludmila Topchieva
ul. Pushkinskaya 11, Petrozavodsk, 198910; topchieva67@mail.ru
Received: 31.10.2017 Accepted: 02.03.2018
DOI: 10.24075/brsmu.2018.008
АНАЛИЗ АССОЦИАЦИИ ПОЛИМОРФНЫХ ВАРИАНТОВ T>C RS767455 ГЕНА TNFRSF1A И T>G RS1061622 ГЕНА TNFRSF1BС РАЗВИТИЕМ НЕАЛКОГОЛЬНОГО СТЕАТОГЕПАТИТА
Л. В. Топчиева1 И. В. Курбатова1, О. П. Дуданова2, А. А. Шиповская2
1 Институт биологии, Федеральный исследовательский центр "Карельский научный центр Российской академии наук", Петрозаводск
2 Медицинский институт, Петрозаводский государственный университет, Петрозаводск
В этиологии и патогенезе неалкогольной жировой болезни печени (НАЖБП) важны особенности питания, малоподвижный образ жизни и наследственность. Предполагают, что полиморфные варианты генов, кодирующих рецепторы к провоспалительному цитокину фактору некроза опухоли альфа (TNFa) (TNFRI и TNFRII), влияют на предрасположенность людей к развитию НАЖБП. Однако сведения о связи данного заболевания с носительством полиморфных вариантов генов TNFRI и TNFRII почти отсутствуют в литературе. Целью исследования было изучить связь полиморфных вариантов генов TNFRSF1A (T>C rs767455) и TNFRSF1B (T>G rs1061622) с развитием одной из форм НАЖБП — неалкогольного стеатогепатита (НАСГ) и их влияние на биохимические показатели крови. Методом ПЦР-ПДРФ геноти-пировали ДНК, выделенную из венозной крови 151 здорового донора и 242 пациентов с диагнозом НАСГ. Содержание TNFa оценивали с помощью иммуноферментного анализа (ИФА). По результатам, связь полиморфного маркера T>C rs767455 гена TNFRSF1A с развитием НАСГ у жителей Карелии отсутствует. Обнаружена ассоциация с НАСГ полиморфного варианта T>G rs1061622 гена TNFRSF1B. У носителей аллеля G повышен риск развития данного заболевания ОШ = 4,83 (95% ДИ: 2,72-8,57). Влияние генотипа по T>G rs1061622 маркеру гена TNFRSF1B на содержание TNFa и активность аланинаминотрансферазы (АлАТ), аспартатаминотрансферазы (АсАТ) и щелочной фосфатазы (ЩФ) не выявлено. Сделано заключение, что полиморфный вариант T>G rs1061622 гена TNFRSF1B может быть вовлечен в предрасположенность населения Карелии к НАСГ.
Ключевые слова: неалкогольный стеатогепатит, наследственность, фактор некроза опухоли альфа, рецепторы к фактору некроза опухоли альфа, mbTNFRI, sTNFR, ген TNFRSF1A, ген TNFRSF1B, полиморфизм генов, аланинами-нотрасфераза, аспартатаминотрансфераза
Финансирование: финансирование осуществлялось из федерального бюджета на выполнение государственного задания КарНЦ РАН (тема № 02212017-0049) на оборудовании Центра коллективного пользования ФИЦ «Карельский научный центр Российской академии наук», при поддержке стипендии Президента РФ для молодых ученых и аспирантов, осуществляющих перспективные научные исследования и разработки по приоритетным направлениям модернизации российской экономики на 2015-2017 гг; в рамках «Программы стратегического развития Петрозаводского государственного университета в 2013-2017 г.», (НИОКР № 115070110006, ИКРБС № 216022450003), проекта «Разработка технологии скрининговой диагностики неалкогольной жировой болезни печени у лиц с избыточным весом и метаболическим синдромом» № 9173ГУ/2015 от 15.12.2015 г программы «У.М.Н.И.К.».
Для корреспонденции: Топчиева Людмила Владимировна
ул. Пушкинская, д. 11, г Петрозаводск, 198910; Topchieva67@mail.ru
Статья получена: 31.10.2017 Статья принята к печати: 02.03.2018
DOI: 10.24075/vrgmu.2018.008
Progression of nonalcoholic fatty liver disease (NAFLD) and more specifically one of its serious forms, nonalcoholic steatohepatitis (NASH), is accompanied by elevated concentrations of proinflammatory cytokines, such as tumor necrosis factor alpha (TNFa), in the blood plasma and liver [1, 2]. Abnormally high TNFa promotes hepatic inflammation, lipid deposition and peroxidation, stimulates activation of Kupffer cells and hepatocyte apoptosis, and leads to insulin resistance [3]. As plasma TNFa levels go back to normal, the liver function recovers [4, 5].
Proteins belonging to the TNF family exert their biological effects by interacting with TNFR superfamily receptors [6]. TNFa-binding receptors (mbTNFR) are represented by two types of transmembrane proteins: mbTNFRI and mbTNFRII. The intracellular region of mbTNFRI carries a death domain absent in mbTNFRII. Once activated, the death domain triggers either apoptosis or necroptosis [7]. Another type of TNFa receptors are soluble sTNFRs, a product of mbTNFR ectodomain shedding mediated by ADAM metalloproteinases [8]. sTNFRs bind to TNFa and act as mbTNFR antagonists preventing activation of TNFa-signaling pathways. Low concentrations of soluble TNFa receptors can be found in the blood serum and urine of healthy individuals. Patients with chronic viral hepatitis [9], cirrhosis [10], or NAFLD [11, 12] have elevated levels of circulating TNFR, which indicates inflammation and activation of T-cell immunity, in particular CD8+ T-cells that express metalloproteinase ADAM-17 [8]. It is hypothesized that both levels and ratio of soluble to membrane-bound TNFa receptors play a significant role not only in inducing hepatocyte death and damage to the liver, but also in the regeneration and homeostasis of this organ [13, 14, 15, 16]. It appears that the ratio of soluble to membrane-bound TNFRI and TNFRII largely determines the intensity of immune response and inflammatory reactions. It has been shown that mutations in the TNFRSF1A and TNFRSF1B genes affect sTNFRI and sTNFRII concentrations in the blood plasma and the number of mbTNFRI and mbTNFRII proteins on the surface of innate immunity cells [17]. Therefore, we can hypothesize that polymorphisms of genes coding for TNFa receptors may substantially contribute to the etiology and pathogenesis of liver diseases, including NAFLD. At present, attempts are made to establish an association between polymorphic variants of TNFR-encoding genes and NAFLD. The data is still scarce, describing mostly a link between TNFRSF1A or TNFRSF1B polymorphisms and biliary cirrhosis, alcoholic liver disease and hepatocellular carcinoma [18, 19, 20]. Associations between polymorphisms of TNFa receptor genes and NAFLD are hardly reported in the literature. That said, we decided to investigate how TNFRSF1A and TNFRSF1B polymorphisms contribute to the development of NAFDL in Karelian residents.
METHODS
Venous blood sample collection was aided by the Department of Propedeutics of Internal Diseases and Hygiene (Institute of Medicine, Petrozavodsk State University) and the Laboratory for Clinical Diagnostics of the Clinical Hospital at Petrozavodsk Station (Russian Railways JSC ). The study recruited 110 male and 132 female patients with NASH (242 patients in total) and 151 healthy individuals (64 males and 87 females). The healthy donors also underwent a medical checkup by the doctors of the Clinical Hospital at Petrozavodsk Station (Russian Railways JSC). All participants were divided into 2 groups: healthy controls with no clinical symptoms of NAFLD (mean age of 48.04 ± 2.26 years) and patients with NASH (mean age of 50.14 ± 2.46 years). The age did not differ significantly
between the groups (U = 132.5; p = 0.637). The study included individuals of both sexes who gave informed consent to participate. Among other general criteria for inclusion were: Karelian residency, negative HBsAg and hepatitis C antibody tests (no chronic viral hepatitis), the absence of alcoholic, drug-induced or autoimmune liver diseases confirmed by medical history and clinical or laboratory tests. The main group included patients with a first-time diagnosis of mild to moderate NASH (prior to treatment). Exclusion criteria for both groups were: infectious or inflammatory diseases within a month before the study, pregnancy or lactation, smoking, diabetes mellitus, body mass index > 30 kg/m2, drug therapy, intake of hepatotropic drugs. The diagnosis was established based on standard clinical, laboratory, instrumental and histological tests. The following blood parameters were evaluated: ALT, AST, and ALP (measured on the RandomAccessF-15 analyzer by BioSystems, Spain). Ultrasound scans revealed enlarged liver and increased parenchymal echogenicity in all patients with NASH. In some cases, the diagnosis was confirmed by liver biopsy.
Prior to drug therapy, 10 ml of venous blood were collected into EDTA-containing vacuum test tubes, of which 250 pL were used for DNA extraction. Some venous blood was used to obtain 200 pL plasma samples for measuring TNFa concentrations. The remaining blood volume was used for biochemistry tests.
The study was approved by the Committee on Medical Ethics of Petrozavodsk State University and Ministry of Health and Social Development of the Republic of Karelia (Protocol 39 dated November 15, 2017).
TNFa concentrations were measured in randomly selected blood plasma samples by ELISA using the Human TNFa Platinum ELISA kit (eBioscience, Austria). It total, 30 plasma samples of healthy donors (mean age of 49.11 ± 1.81 years) and 60 samples of patients with NASH (mean age of 49.95 ± 2.74 years) were tested; male and female samples were equally represented. The age did not differ significantly between the groups (U = 181.5; p = 0.535). Optical density of the solution was measured on the microplate reader Sunrise (Tecan, Austria) at 450 nm wavelength and 620 nm reference wavelength.
DNA was extracted from the peripheral blood on microcolumns using the K-Sorb kit (Syntol, Russia). Quality and quantity of the obtained DNA were evaluated on the SmartSpec spectrophotometer (Bio-Rad, USA).
To amplify the region of the TNFRSF1A gene harboring position 339 (rs767455), the following primers were used: forward 5'agtggctgaggttaggac3' and reverse 5'ctatgcccgagt ctcaac3' described in [21]. To amplify the region of the TNFRSF1B gene harboring position 587 (rs1061622), the following primers were used: forward 5'gcacacatcgtcactctc3' and reverse 5'aaggagtgaatgaatgagac3'described in [21]. Polymerase chain reaction (PCR) was carried out in the iCycler iQ5 (Bio-Rad, USA) using a reaction mix by Evrogen, Russia. PCR products containing rs767455 were incubated with 1 unit Bse1 I restriction endonuclease (SibEnzyme, Russia) for 3 hours at 65 °C. PCR products containing rs1061622 were incubated with 1 unit Fat I restriction endonuclease (SibEnzyme, Russia) for 1 hour at 55 °C. Then DNA fragments were separated in 1.5% agarose gel using the tris-acetate buffer.
The obtained data were processed in Statgraphics 2.1. Differences in allele and genotype frequencies between the two groups were assessed using the x2 test; differences in biochemical parameters were assessed using the nonparametric Mann-Whitney-Wilcoxon U test. The latter was employed because distribution in the groups was not normal.
To assess how different genotypes affected blood biochemistry, the Kruskal-Wallis test was used. To estimate the risk of developing NASH, we calculated the odds ratio (OR) and the 95% confidence interval (CI) [22]. Differences were considered significant at p < 0.05.
RESULTS
Figures 1 and 2 show electrophoresis of rs767455-and rs1061622- containing PCR products after restriction digest.
TNFRSF1AT>C (rs767455) allele and genotype frequencies have been analyzed in patients with NASH and healthy controls.
The datasets were tested for deviations from the Hardy-Weinberg equilibrium. Both healthy controls and patients with NASH demonstrated deviations for allele and genotype frequencies (x2 = 8.25 (df = 2, p < 0.05), x2 = 21.64 (df = 2, p < 0.05), respectively).
Table 1 shows that frequencies of T>C (rs767455) alleles and genotypes did not differ between patients with NASH and healthy donors.
We have also analyzed the frequencies of TNFRSF1B 587T>G alleles and genotypes in patients with NASH and healthy controls.
The two studied groups did deviate from the Hardy-Weinberg equilibrium (x2 = 0.30 (df = 2, p > 0.05), x2 = 4.16 (df = 2, p > 0.05) for healthy donors and patients with NASH, respectively).
Table 2 shows that TNFRSF1B 587T>G allele and genotype frequencies differed between the healthy donors and patients with NASH. The G allele was far more frequent in patients with NASH than in healthy individuals. Carriers of the G allele are at a higher risk of developing NASH (OR = 4.83; 95% CI: 2.72-8.57).
We have also assessed the effect of the TNFRSF1B polymorphism (rs1061622) on liver function tests and plasma TNFalevels (Table 3). No significant differences were observed regarding the studied parameters between carriers of two different genotypes in the compared groups. The genotype did not have any effect on blood biochemistry both in patients with NASH and healthy controls (p > 0.05).
DISCUSSION
We have attempted to establish an association between two polymorphisms rs767455 and rs1061622 of genes TNFRSF1A and TNFRSF1B, respectively, and susceptibility to NASH. According to the literature, these polymorphisms are associated with a few inflammatory diseases and abnormal levels of TNFa in the blood plasma [23]. The rs767455 polymorphism of gene TNFRSF1A is a synonymous mutation at position 36 of exon 1. Synonymous mutations are known to disrupt mRNA splicing, alter mRNA structure and affect protein folding [24]. It has been shown that adenine to guanine substitution at position 36 of TNFRSF1A leads to a CCA to CCG codon change, disrupting translation [25]. In combination with other TNFRSF1A mutations (haplotype T-A-T at rs4149570-rs767455-rs1800692), it leads to the reduced abundance of exon 2-skipping products [26]. We have not established an association between the rs76 7455polymorphismandsusceptibilityto NASH in the study participants. However, we have discovered an association between the G allele carriership (rs1061622, TNFRSF1B) and the risk of this disease.
Thers1061622 polymorphism of the TNFRSF1B gene is a thymine to guanine substitution at position 587 of exon 6 that leads to a methionine to arginine amino acid substitution
at position 196 of the protein's transmembrane domain, near the site of proteolytic cleavage by ADAM metalloproteases. This mutation affects ectodomain shedding (cleavage of the intracellular fragment of the transmembrane protein and its release into the extracellular matrix). Some researchers have shown that TT (Met196) genotype carriers have lower levels of sTNFRII than those with the Arg196 receptor variant [27]. Other authors report that carriers of TT+TG genotypes at this locus have higher levels of sTNFRII in the blood plasma than donors with the GG genotype [28].
Thus, the rs1061622 polymorphism can alter the ratio of membrane-bound to soluble TNFRII both in health and inflammation. Patients with liver diseases have elevated levels of sTNFRI and sTNFRII in the blood plasma and liver that positively correlate with disease severity [10, 12, 29, 30]. However, the role of increased ectodomain shedding of TNFa receptors in inflammation is not absolutely clear. Elevated concentrations of sTNFRII accompanied by reduced number of mbTNFRII on cell surface can trigger mbTNFRI-mediated signaling pathways leading to apoptosis [7]. Besides, soluble TNFR can act as physiological attenuators of TNFa activity, competing for the ligand with membrane-bound receptors. However, it appears that soluble receptors are capable of stabilizing and preserving circulating TNFa and thus act as its agonists [31].
The Met196 andArg196 variants of TNFRII differ in their ability to mediate TNF signaling and trigger apoptosis or necroptosis. Epithelial HeLaS3 cells transfected with the pcDNA3.1 plasmid containing the Arg196 allele of TNFRII demonstrated reduced activity of the nuclear factor kB and poor recruitment of TRAF2 upon stimulation with recombinant TNFa [32]. Subsequent activation of TNFRI signaling pathway in these cells induced apoptosis while in the cells transfected with the plasmid containing the wild type Met196, survival rates were better. Importantly, NASH is accompanied by the
М 1 2 3
Fig. 1. Electrophoresis of rs767455-containing PCR products after restriction digest: M — Thermo Scientific GeneRuler Low range DNA Ladder, 1 — genotype CC (330 bp), 2 — genotype TC (330, 184 and 146 bp), 3 — genotype TT (184 and 146 bp)
М 1 2 3
» ■
m
1MB ^^BP
m
** ■a s **
Fig. 2. Electrophoresis of rs1061622-containing PCR products after restriction digest: M — Thermo Scientific GeneRuler Low range DNA Ladder, 1 — genotype TT (235 and 144 bp),2 — genotype TG (379, 235 and 144 bp), 3 — genotype GG (379 bp)
Table 1. Distribution of TNFRSF1AT>C (rs767455) alleles and genotypes in patients with NASH and healthy control
Alleles and genotypes Controls (n = 131) Patients with NASH (n = 242) X2
T 119 (0.45) 229 (0.47) 0.24 (df = 1, p > 0.05)
C 143 (0.55) 255 (0.53)
TT 35 (0.26) 72 (0.30) 0.61 (df = 2, p > 0.05)
TC 48 (0.37) 85 (0.35)
CC 48 (0.37) 85 (0.35)
Table 2. Distribution of TNFRSF1BT>G (rs1061622) alleles and genotypes in patients with NASH and healthy controls
Alleles and genotypes Controls (n = 151) Patients with NASH (n = 133) X2
T 206 (0.68) 116 (0.44) 16.60 (df = 1, p < 0.05)
G 96 (0.32) 150 (0.56)
TT 69 (0.46) 20 (0.15) 37.07 (df = 2, p < 0.01)
TG 68 (0.45) 77 (0.58)
GG 14 (0.09) 36 (0.27)
Table 3. Liver function parameters in healthy and diseased TNFRSF1B587T>G (rs1061622) carriers
Parameter Controls Patients with NASH
Genotype TT (n = 14) TG + GG (n = 16) TT (n = 20) TG + GG (n = 40)
ALT, un/l 17.29 ± 2.05 18.31 ± 2.34 59 36 ± 8.53 65.56 ± 8.68
(17.05) (18.27) (45.90) (48.30)
AST, un/l 24.36 ± 2.64 22.08 ± 2.72 51.22 ± 9.65 51.51 ± 6.27
(19.50) (19.09) (41.05) (35.60)
ALP, un/l 118.42 ± 10.82 123.51 ± 17.14 218.00 ± 18.70 214.26 ± 11.28
(117.46) (125.48) (210.00) (197.00)
TNFa, pg/ml 5.53 ± 1.38 4.82 ± 0.39 6.09 ± 0.43 6.36 ± 0.27
(4.69) (5.08) (5.83) (6.27)
Note: data are represented as mean and error mean (M ± m). The median is shown in brackets.
death of hepatocytes [33]. We hypothesize that the rs1061622 polymorphism of the TNFRSF1B gene contributes to the development and progression of NASH through activation of signaling pathways that induce hepatic cell death.
The rs1061622 polymorphism affects the levels of proinflammatory cytokines, which provides another explanation of its involvement into the etiology and pathogenesis of NASH[34]. We have studied plasma concentrations of TNFa in healthy and diseased carriers of different alleles and genotypes to reveal no significant differences between the groups. However, we cannot claim the absence of any effect of the TNFRSF1B polymorphism rs1061622 on TNFa levels because of a small sample size (especially true for the controls) and
some other factors that may affect this parameter. Therefore, the role of this polymorphism in the development of NASH needs to be further investigated.
CONCLUSIONS
No association has been found between the rs767455 T>C TNFRSF1A polymorphism and the development of NASH in Karelian residents. We have however discovered an association between the rs1061622 T>G TNFRSF1B polymorphism and the disease. This polymorphic marker can be implicated in the genetic predisposition to NASH among the residents of Karelia.
References
1. Lebensztejn DM, Kowalczuk D, Tarasow E, Skiba E, Kaczmarski M. Tumor necrosis factor alpha and its soluble receptors in obese children with NAFLD. Adv Med Sci. 2010; 55 (1): 74-9. PubMed PMID: 20371430. DOI: 10.2478/v10039-010-0008-5.
2. Bocsan IC, Milaciu MV, Pop RM, Vesa SC, Ciumarnean L, Matei DM et al. Cytokines genotype-phenotype correlation in nonalcoholic steatohepatitis. Oxid Med Cell Longev. 2017; 2017:4297206. Epub 2017 Aug 9. PubMed PMID: 28852433. DOI: 10.1155/2017/4297206.
3. Braunersreuther V, Viviani GL, Mach F, Montecucco F. Role of cytokines and chemokines in non-alcoholic fatty liver disease. World Journal of Gastroenterology. 2012; 18: 727-35. PubMed PMID: 22371632. DOI: 10.3748/wjg.v18.i8.727.
4. Lee Y-M, Sutedja DS, Wai C-T, Dan Y-Y, Aung M-O, Zhou L et al. A randomized controlled pilot study of Pentoxifylline in patients
with non-alcoholic steatohepatitis (NASH). Hepatol Int. 2008; 2 (2): 196-201. PubMed PMID: 19669304. DOI: 10.1007/s12072-008-9058-1.
5. Kakino S, Ohki T, Nakayama H, Yuan X, Otabe S, Hashinaga T et al. Pivotal role of TNF-a in the development and progression of nonalcoholic fatty liver disease in a murine model. Horm Metab Res. 2017 Sep 18. [Epub ahead of print]. PubMed PMID: 28922680. DOI: 10.1055/s-0043-118666.
6. Locksley RM, Killeen N, Lenardo MJ. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell. 2001; 104: 487-501. PubMed PMID: 11239407.
7. Cabal-Hierro L, Lazo PS. Signal transduction by tumor necrosis factor receptors. Cellular Signalling. 2012; 24: 1297-1305. PubMed PMID: 22374304. DOI: 10.1016/j.cellsig.2012.02.006.
8. DeBerge MP, Ely KH, Wright PF, Thorp EB, Enelow RI. Shedding of TNF receptor 2 by effector CD8+ T cells by ADAM17 is important
for regulating TNF-a availability during influenza infection. JLeukocBiol. 2015; 98: 423-34. PubMed PMID: 26019295. DOI: 10.1189/jlb.3A0914-432RR.
9. Levitan BN, Astahin AV, Levitan GB. Faktor nekroza opuholej i ego rastvorimye receptory II tipa pri hronicheskih gepatitah i cirrozah pecheni. Jeksperimental'naja i klinicheskaja gastrojenterologija. 2017; 2: 62-6. Russian.
10. Lin SY, Wang YY, Sheu WH. Increased serum leptin concentration correlate with soluble tumour necrosis factor receptor levels in patients with cirrhosis. Clinical Endocrinol (Oxf). 2002; 57: 80511. PubMed PMID: 12460331.
11. Hui JM, Hodge A, Farrell GC, Kench JG, Kriketos A, George J. Beyond insulin resistance in NASH: TNF-alpha or adipo-nectin? Hepatology. 2004; 40: 46-54. PubMed PMID: 15239085.
12. Tokushige K, Takakura M, Tsuchiya-Matsushita N, Taniai M, Hashimoto E, Shiratori K. Influence of TNF gene polymorphisms in Japanese patients with NASH and simple steatosis. J Hepatol. 2007; 46: 1104-10. PubMed PMID: 17395331. DOI: 10.1016/j. jhep.2007.01.028.
13. Tarrats N, Moles A, Morales A, García-Ruiz C, Fernández-Checa JC, Marí M. Critical role of tumor necrosis factor receptor 1, but not 2, in hepaticstellate cell proliferation, extracellular matrix remodeling, and liver fibrogenesis. Hepatology. 2011; 54: 31927. PubMed PMID: 21523796. DOI: 10.1002/hep.24388.
14. Ijiri Y, Katoa R, Sadamatsua M, Takano M, Okadac Y, Tanaka K et al. Chronological changes in circulating levels of soluble tumor necrosis factor receptors 1 and 2 in rats with carbon tetrachloride-induced liver injury. Toxicology. 2014; 316: 55-60 PubMed PMID: 24389507. DOI: 10.1016/j.tox.2013.12.004.
15. Sorg U, Behnke K, Degrandi D, Reich M, Keitel V, Herebian D, et al. Cooperative role of lymphotoxin b receptor and tumor necrosis factor receptor p55 in murine liver regeneration. Journal of Hepatology. 2016; 64: 1108-17. PubMed PMID: 26708145. DOI: 10.1016/j.jhep.2015.12.006.
16. Lana JP, Martins LB, Oliveira MC, Menezes-Garcia Z, Yamada LT, Vieira LQ et al. TNF and IL-18 cytokines may regulate liver fat storage under homeostasis conditions. Appl Physiol Nutr Metab. 2016; 41: 1295-1302. PubMed PMID: 27863204. DOI: 10.1139/ apnm-2016-0265.
17. Sennikov SV, Vasilyev FF, Lopatnikova JA, Shkaruba NS, Silkov AN. Polymorphisms in the tumor necrosis factor receptor genes affect the expression levels of membrane-bound type I and type II receptors. Mediators Inflamm. 2014; 2014:745909. Epub 2014 Mar 24. PubMed PMID: 24782596. DOI: 10.1155/2014/745909.
18. Wang J, Ni H, Chen L, Liu YX, Chen CB, Song WQ. Preparation and analysis of cSNP chip on hepatocellular carcinoma-related genes. Hepatobiliary Pancreat Dis Int. 2005; 4: 398-402. PubMed PMID: 16109524.
19. Machado MV, Martins A, Almeida R, Marques-Vidal P, Gonçalves MS, Camilo ME et al. Does the simultaneous tumor necrosis factor receptor 2, tumor necrosis factor promoter gene polymorphism represent a higher risk for alcoholic liver disease? Eur J Gastroenterol Hepatol. 2009; 21: 201-5. PubMed PMID: 19212208. DOI: 10.1097/MEG.0b013e32831016e0.
20. Liu X, Invernizzi P, Lu Y. Kosoy R, Lu Y, Bianchi I et al. Genome-wide meta-analyses identify three loci associated with primary biliary cirrhosis. Nat Genet. 2010; 42: 658-60. PubMed PMID: 20639880. DOI: 10.1038/ng.627.
21. Xu F, Zhou G, Han S, Yuan W, Chen S, Fu Z et al. Association of TNF-a, TNFRSF1A and TNFRSF1B gene polymorphisms with the risk of sporadic breast cancer in northeast Chinese Han women. PloS One. 2014; 9 (7): e101138. PubMed PMID: 25010932. DOI:
10.1371/journal.pone.0101138.
22. Fletcher R. Klinicheskaja jepidemiologija. M.: Izd-vo «Media-Sfera»; 1998. 352 p. Russian.
23. Glossop JR, Dawes PT, Nixon NB, Mattey DL. Polymorphism in the tumor necrosis factor receptor II gene is associated with circulating levels of soluble tumor necrosis factor receptors in rheumatoid arthritis. Arthritis Research & Therapy. 2005; 7: 122734. PubMed PMID: 16277675. DOI: 10.1186/ar1816.
24. Hunt R, Sauna ZE, Ambudkar SV, Gottesman MM, Kimchi-Sarfaty C. Silent (synonymous) SNPs: should we care about them? Methods Mol Biol. 2009; 578: 23-39. PubMed PMID: 19768585. DOI: 10.1007/978-1-60327-411-1-2.
25. Matsukura H, Ikeda S, Yoshimura N, Takazoe M, Muramatsu M. Genetic polymorphisms of tumor necrosis factor receptor superfamily 1A and 1B affect responses to infliximab in Japanese patients with Crohn's disease. Aliment Pharmacol Ther. 2008; 27: 765-70. PubMed PMID: 18248655. DOI: 10.1111/j.1365-2036.2008.03630.x.
26. Rittore C, Sanchez E, Soler S, Albers M, Obici L et al. Grandemange S0R10-002 - A novel TNFR1 transcript of TRAPS gene. Pediatr Rheumatol Online J. 2013; 11: A186. PMCID: PMC3953180. DOI: 10.1186/1546-0096-11-S1-A186.
27. Tolusso B, Sacco S, Gremese E, La Torre G, Tomietto P, Ferraccioli GF. Relationship between the tumor necrosis factor receptor II (TNF-RII) gene polymorphism and sTNF-RII plasma levels in healthy controls and in rheumatoid arthritis. Hum Immunol. 2004; 65 (12): 1420-6. PubMed PMID: 15603867. DOI: 10.1016/j.humimm.2004.06.010.
28. Stark GL, Dickinson AM, Jackson GH, Taylor PR, Proctor SJ, Middleton PG. Tumor necrosis factor receptor type II 196M/R genotype correlates with circulating soluble receptor levels innormal subjects and with graft-versus-host disease after sibling allogeneic bone marrow transplantation. Transplantation. 2003; 76: 1742-49. PubMed PMID: 14688526. DOI: 10.1097/01. TP.0000092496.05951.D5.
29. Crespo J, Cayón A, Fernández-Gil P, Hernández-Guerra M, Mayorga M, Domínguez-Díez A et al. Gene expression of tumor necrosis factor alpha and TNF-receptors, p55 and p75, in nonalcoholic ste-atohepatitis patients. Hepatology. 2001; 34: 1158-63. PubMed PMID: 11732005.
30. Cubillas R, Kintner K, Phillips F, Karandikar NJ, Thiele DL, Brown GR. Tumor necrosis factor receptor 1 expression is upregulated in dendritic cells in patients with chronic HCV who respond to therapy. Hepat Res Treat. 2010; 2010:429243. PMCID: PMC2989713. DOI: 10.1155/2010/429243.
31. Aderka D. The potential biological and clinical significance of the soluble tumor necrosis factor receptors. Cytokine Growth Factor Rev. 1996; 7: 231-240. PubMed PMID: 8971478.
32. Till A, Rosenstiel P, Krippner-Heidenreich A, Mascheretti-Croucher S, Croucher PJ, Schäfer H et al. The Met196Arg variation of human TNFR2 affects TNF alpha induced apoptosis by impaired NF-KB-signalling and target gene expression. J Biol Chem. 2005; 280: 5994-6004. PubMed PMID: 15572357, DOI: 10.1074/jbc.M411541200.
33. Malhi H, Guicciardi ME, Gores GJ. Hepatocyte death: a clear and present danger. Physiol Rev. 2010; 90: 1165-1194. PubMed PMID: 20664081.
34. Morita C, Horiuchi T, Tsukamoto H, Hatta N, Kikuchi Y, Arinobu Y et al. Association of tumor necrosis factor receptor type II polymorphism 196R with Systemic lupus erythematosus in the Japanese: molecular and functional analysis. Arthritis Rheum. 2001; 44 (12): 2819-27. PubMed PMID: 11762942.
Литература
1. Lebensztejn DM, Kowalczuk D, Tarasow E, Skiba E, Kaczmarski M. Tumor necrosis factor alpha and its soluble receptors in obese children with NAFLD. Adv Med Sci. 2010; 55 (1): 74-9. PubMed PMID: 20371430. DOI: 10.2478/v10039-010-0008-5.
2. Bocsan IC, Milaciu MV, Pop RM, Vesa SC, Ciumarnean L,
Matei DM et al. Cytokines genotype-phenotype correlation in nonalcoholic steatohepatitis. Oxid Med Cell Longev. 2017; 2017:4297206. Epub 2017 Aug 9. PubMed PMID: 28852433. DOI: 10.1155/2017/4297206. 3. Braunersreuther V, Viviani GL, Mach F, Montecucco F. Role of cytokines and chemokines in non-alcoholic fatty liver disease.
World Journal of Gastroenterology. 2012; 18: 727-35. PubMed PMID: 22371632. DOI: 10.3748/wjg.v18.¡8.727.
4. Lee Y-M, Sutedja DS, Wa¡ C-T, Dan Y-Y, Aung M-O, Zhou L et al. A randomized controlled pilot study of Pentoxifylline in patients with non-alcoholic steatohepatitis (NASH). Hepatol Int. 2008; 2 (2): 196-201. PubMed PMID: 19669304. DOI: 10.1007/s12072-008-9058-1.
5. Kakino S, Ohki T, Nakayama H, Yuan X, Otabe S, Hashinaga T et al. Pivotal role of TNF-a in the development and progression of nonalcoholic fatty liver disease in a murine model. Horm Metab Res. 2017 Sep 18. [Epub ahead of print]. PubMed PMID: 28922680. DOI: 10.1055/s-0043-118666.
6. Locksley RM, Killeen N, Lenardo MJ. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell. 2001; 104: 487-501. PubMed PMID: 11239407.
7. Cabal-Hierro L, Lazo PS. Signal transduction by tumor necrosis factor receptors. Cellular Signalling. 2012; 24: 1297-1305. PubMed PMID: 22374304. DOI: 10.1016/j.cellsig.2012.02.006.
8. DeBerge MP, Ely KH, Wright PF, Thorp EB, Enelow RI. Shedding of TNF receptor 2 by effector CD8+ T cells by ADAM17 is important for regulating TNF-a availability during influenza infection. J Leukoc Biol. 2015; 98: 423-34. PubMed PMID: 26019295. DOI: 10.1189/jlb.3A0914-432RR.
9. Левитан Б. Н., Астахин А. В., Левитан Г. Б. Фактор некроза опухолей и его растворимые рецепторы II типа при хронических гепатитах и циррозах печени. Экспериментальная и клиническая гастроэнтерология. 2017; 2: 62-6.
10. Lin SY, Wang YY, Sheu WH. Increased serum leptin concentration correlate with soluble tumour necrosis factor receptor levels in patients with cirrhosis. Clinical Endocrinol (Oxf). 2002; 57: 80511. PubMed PMID: 12460331.
11. Hui JM, Hodge A, Farrell GC, Kench JG, Kriketos A, George J. Beyond insulin resistance in NASH: TNF-alpha or adipo-nectin? Hepatology. 2004; 40: 46-54. PubMed PMID: 15239085.
12. Tokushige K, Takakura M, Tsuchiya-Matsushita N, Taniai M, Hashimoto E, Shiratori K. Influence of TNF gene polymorphisms in Japanese patients with NASH and simple steatosis. J Hepatol. 2007; 46: 1104-10. PubMed PMID: 17395331. DOI: 10.1016/j. jhep.2007.01.028.
13. Tarrats N, Moles A, Morales A, García-Ruiz C, Fernández-Checa JC, Marí M. Critical role of tumor necrosis factor receptor 1, but not 2, in hepaticstellate cell proliferation, extracellular matrix remodeling, and liver fibrogenesis. Hepatology. 2011; 54: 31927. PubMed PMID: 21523796. DOI: 10.1002/hep.24388.
14. Ijiri Y, Katoa R, Sadamatsua M, Takano M, Okadac Y, Tanaka K et al. Chronological changes in circulating levels of soluble tumor necrosis factor receptors 1 and 2 in rats with carbon tetrachloride-induced liver injury. Toxicology. 2014; 316: 55-60. PubMed PMID: 24389507. DOI: 10.1016/j.tox.2013.12.004.
15. Sorg U, Behnke K, Degrandi D, Reich M, Keitel V, Herebian D et al. Cooperative role of lymphotoxin b receptor and tumor necrosis factor receptor p55 in murine liver regeneration. Journal of Hepatology. 2016; 64: 1108-17. PubMed PMID: 26708145. DOI: 10.1016/j.jhep.2015.12.006.
16. Lana JP, Martins LB, Oliveira MC, Menezes-Garcia Z, Yamada LT, Vieira LQ et al. TNF and IL-18 cytokines may regulate liver fat storage under homeostasis conditions. Appl Physiol Nutr Metab. 2016; 41: 1295-1302. PubMed PMID: 27863204. DOI: 10.1139/ apnm-2016-0265.
17. Sennikov SV, Vasilyev FF, Lopatnikova JA, Shkaruba NS, Silkov AN. Polymorphisms in the tumor necrosis factor receptor genes affect the expression levels of membrane-bound type I and type II receptors. Mediators Inflamm. 2014; 2014:745909. Epub 2014 Mar 24. PubMed PMID: 24782596. DOI: 10.1155/2014/745909.
18. Wang J, Ni H, Chen L, Liu YX, Chen CB, Song WQ. Preparation and analysis of cSNP chip on hepatocellular carcinoma-related genes. Hepatobiliary Pancreat Dis Int. 2005; 4: 398-402. PubMed PMID: 16109524.
19. Machado MV, Martins A, Almeida R, Marques-Vidal P, Gongalves MS, Camilo ME et al. Does the simultaneous tumor necrosis factor receptor 2, tumor necrosis factor promoter gene polymorphism represent a higher risk for alcoholic liver disease?
Eur J Gastroenterol Hepatol. 2009; 21: 201-5. PubMed PMID: 19212208. DOI: 10.1097/MEG.0b013e32831016e0.
20. Liu X, Invernizzi P, Lu Y. Kosoy R, Lu Y, Bianchi I et al. Genome-wide meta-analyses identify three loci associated with primary biliary cirrhosis. Nat Genet. 2010; 42: 658-60. PubMed PMID: 20639880. DOI: 10.1038/ng.627.
21. Xu F, Zhou G, Han S, Yuan W, Chen S, Fu Z et al. Association of TNF-a, TNFRSF1A and TNFRSF1B gene polymorphisms with the risk of sporadic breast cancer in northeast Chinese Han women. PloS One. 2014; 9 (7): e101138. PubMed PMID: 25010932. DOI: 10.1371/journal.pone.0101138.
22. Флетчер Р. Клиническая эпидемиология. М.: Изд-во «Медиа-Сфера»; 1998. 352 с.
23. Glossop JR, Dawes PT, Nixon NB, Mattey DL. Polymorphism in the tumor necrosis factor receptor II gene is associated with circulating levels of soluble tumor necrosis factor receptors in rheumatoid arthritis. Arthritis Research & Therapy. 2005; 7: 122734. PubMed PMID: 16277675. DOI: 10.1186/ar1816.
24. Hunt R, Sauna ZE, Ambudkar SV, Gottesman MM, Kimchi-Sarfaty C. Silent (synonymous) SNPs: should we care about them? Methods Mol Biol. 2009; 578: 23-39. PubMed PMID: 19768585. DOI: 10.1007/978-1-60327-411-1-2.
25. Matsukura H, Ikeda S, Yoshimura N, Takazoe M, Muramatsu M. Genetic polymorphisms of tumor necrosis factor receptor superfamily 1A and 1B affect responses to infliximab in Japanese patients with Crohn's disease. Aliment Pharmacol Ther. 2008; 27: 765-70. PubMed PMID: 18248655. DOI: 10.1111/j.1365-2036.2008.03630.x.
26. Rittore C, Sanchez E, Soler S, Albers M, Obici L, McDermott MF et al. Grandemange SOR10-002 - A novel TNFR1 transcript of TRAPS gene. Pediatr Rheumatol Online J. 2013; 11: A186. PMCID: PMC3953180. DOI: 10.1186/1546-0096-11-S1-A186.
27. Tolusso B, Sacco S, Gremese E, La Torre G, Tomietto P, Ferraccioli GF. Relationship between the tumor necrosis factor receptor II (TNF-RII) gene polymorphism and sTNF-RII plasma levels in healthy controls and in rheumatoid arthritis. Hum Immunol. 2004; 65 (12): 1420-6. PubMed PMID: 15603867. DOI: 10.1016/j.humimm.2004.06.010.
28. Stark GL, Dickinson AM, Jackson GH, Taylor PR, Proctor SJ, Middleton PG. Tumor necrosis factor receptor type II 196M/R genotype correlates with circulating soluble receptor levels innormal subjects and with graft-versus-host disease after sibling allogeneic bone marrow transplantation. Transplantation. 2003; 76: 1742-49. PubMed PMID: 14688526, DOI: 10.1097/01. TP.0000092496.05951.D5.
29. Crespo J, Cayón A, Fernández-Gil P, Hernández-Guerra M, Mayorga M, Domínguez-Díez A et al. Gene expression of tumor necrosis factor alpha and TNF-receptors, p55 and p75, in nonalcoholic ste-atohepatitis patients. Hepatology. 2001; 34: 1158-63. PubMed PMID: 11732005.
30. Cubillas R, Kintner K, Phillips F, Karandikar NJ, Thiele DL, Brown GR. Tumor necrosis factor receptor 1 expression is upregulated in dendritic cells in patients with chronic HCV who respond to therapy. Hepat Res Treat. 2010; 2010: 429243. PMCID: PMC2989713. DOI: 10.1155/2010/429243.
31. Aderka D. The potential biological and clinical significance of the soluble tumor necrosis factor receptors. Cytokine Growth Factor Rev. 1996; 7: 231-240. PubMed PMID: 8971478.
32. Till A, Rosenstiel P, Krippner-Heidenreich A, Mascheretti-Croucher S, Croucher PJ, Schäfer H et al. The Met196Arg variation of human TNFR2 affects TNF alpha induced apoptosis by impaired NF-KB-signalling and target gene expression. J Biol Chem. 2005; 280: 5994-6004. PubMed PMID: 15572357. DOI: 10.1074/jbc.M411541200.
33. Malhi H, Guicciardi ME, Gores GJ. Hepatocyte death: a clear and present danger. Physiol Rev. 2010; 90: 1165-1194. PubMed PMID: 20664081.
34. Morita C, Horiuchi T, Tsukamoto H, Hatta N, Kikuchi Y, Arinobu Y et al. Association of tumor necrosis factor receptor type II polymorphism 196R with Systemic lupus erythematosus in the Japanese: molecular and functional analysis. Arthritis Rheum. 2001; 44 (12): 2819-27. PubMed PMID: 11762942.
