A malacological study of the Ukok Plateau lakes Текст научной статьи по специальности «Биологические науки»

AOÖÖ

AMypcKuü зооAогинескиü rnypnaA, 2024, m. XVI, № 3

Amurian Zoological Journal, 2024, vol. XVI, no. 3

www.azjournal.ru

N Check for updates

https://www.doi.org/10.33910/2686-9519-2024-16-3-633-644 https://zoobank.org/References/E412084A-3FFC-49E6-85DF-88CAF98BAB5D

UDC 594.38

A malacological study of the Ukok Plateau lakes

G. L. Ataev1H, R. R. Usmanova1, E. E. Prokhorova1, V. V. Glupov2

1 Herzen State Pedagogical University of Russia, 48 Moika Emb., 191186, Saint Petersburg, Russia 2 Russian Academy of Sciences, Head of the Institute of Systematics and Ecology of Animals, 11 Frunze Str., 630091,

Novosibirsk, Russia

Authors

Gennady L. Ataev

E-mail: ataev.gennady@gmail.com

SPIN: 6944-3950

Scopus Author ID: 6602555237

ResearcherlD: Q-7655-2016

ORCID: 0000-0002-4740-2117

Regina R. Usmanova

E-mail: rregina.usmanova@gmail.com

SPIN: 5197-2224

Scopus Author ID: 57201395298

ResearcherID: AAH-5585-2019

ORCID: 0009-0001-4273-7751

Elena E. Prokhorova

E-mail: elenne@mail.ru

SPIN: 9064-0306

Scopus Author ID: 36632856500

ResearcherID: J-7895-2016

ORCID: 0000-0002-4451-5124

Viktor V. Glupov

E-mail: skif@eco.nsc.ru SPIN: 2661-6099 Scopus Author ID: 6603567679 ResearcherID: N-7706-2014 ORCID: 0000-0003-1866-9952

Abstract. The article reports on the results of an interdisciplinary scientific expedition to the Ukok Plateau of the Kosh-Agachsky District, Altai Republic, Russia, that took place in August 2021. Freshwater molluscs were collected from the lakes Ukok and Kaldzhin-Kul. The morphological and molecular genetic analyses show that the snails collected from the two lakes are of the Ampullaceana lagotis species. However, the study identified a range of morphological and genetic differences between the molluscs from the two different lakes. This indicates that they represent isolates. In addition, the lack of intrapopulation variability in A. lagotis molluscs may indicate a relatively recent settlement of these snails in the lakes Ukok and Kaldzhin-Kul.

Copyright: © The Authors (2024). Published by Herzen State Pedagogical

University of Russia. Open access under Keywords: Altai, Ukok Plateau, molluscs, Ampullaceana lagotis, Lake Ukok,

CC BY-NC License 4.0. Lake Kaldzhin-Kul, isolates

Малакологическое изучение озер плоскогорья Укок

Г. Л. Атаевш, Р. Р. Усманова1, Е. Е. Прохорова1, В. В. Глупов2

1 Российский государственный педагогический университет им. А. И. Герцена, наб. р. Мойки, д. 48,

191186, г. Санкт-Петербург, Россия 2 Институт систематики и экологии животных СО РАН, ул. Фрунзе, д. 11, 630091, г. Новосибирск, Россия

Сведения об авторах Атаев Геннадий Леонидович E-mail: ataev.gennady@gmail.com SPIN-код: 6944-3950 Scopus Author ID: 6602555237 ResearcherlD: Q-7655-2016 ORCID: 0000-0002-4740-2117

Усманова Регина Рустамовна E-mail: rregina.usmanova@gmail.com SPIN-код: 5197-2224 Scopus Author ID: 57201395298 ResearcherID: AAH-5585-2019 ORCID: 0009-0001-4273-7751

Прохорова Елена Евгеньевна E-mail: elenne@mail.ru SPIN-код: 9064-0306 Scopus Author ID: 36632856500 ResearcherID: J-7895-2016 ORCID: 0000-0002-4451-5124 Глупов Виктор Вячеславович E-mail: skif@eco.nsc.ru SPIN-код: 2661-6099 Scopus Author ID: 6603567679 ResearcherID: N-7706-2014 ORCID: 0000-0003-1866-9952

Аннотация. В августе 2021 г. в рамках комплексной экспедиции на плоскогорье Укок (Кош-Агачский район Республики Алтай) были собраны пресноводные моллюски в озерах Укок и Кальджин-Куль. На основании морфологического и молекулярно-генетического анализа улитки из обоих озер отнесены к виду Атри11асеапа 1а§ой&. Однако определенные морфологические и генетические отличия между моллюсками из разных озер позволяют определить их как изоляты. Кроме того, отсутствие внутрипопуляционной вариабельности моллюсков А. lagotis может свидетельствовать об относительно недавнем заселении улиток этого вида в озера Укок и Кальджин-Куль.

Права: © Авторы (2024). Опубликовано Российским государственным педагогическим университетом им. А. И. Герцена. Открытый доступ на условиях лицензии CC BY-NC 4.0.

Introduction

Ключевые слова:

lagotis, озеро Укок,

The scientific expedition that lasted from 27 to 29 August 2021 explored the Ukok and Kaldzhin-Kul lakes on the Ukok Plateau of the Kosh-Agachsky District, Altai Republic, Russia. The average absolute elevations of the Ukok Plateau range from 2,200 to 2,500 metres.

The Ukok Plateau is bounded by high mountains with altitudes of4,000 m and higher (e. g., the 4,134 m high mountain Russky Shater of the Tavan-Bogdo-Ul Range) with the South Chuysky Ridge of the Central Altai in the north and north-east, the Karaalakhinsky Mountains in the west and the foot of the Say-lyugem Mountains up to the Tarkhatinskaya Basin in the east. In the south, the Plateau is bounded by the following ranges: Saylyugem

Алтай, плоскогорье Укок, моллюски, Ampullaceana озеро Кальджин-Куль, изоляты

(western end), Tavan-Bogdo-Ul and Southern Altai. The Ukok Plateau is the result of erosion and denudation in the Mesozoic, the Pa-leogene and the Neogene (Bogachkin 1981). Some of its geomorphological structures have higher than average absolute elevations, e.g., the Kyzyltas Range (2,646 m).

The Ukok Plateau is permafrost. Its climate is extremely continental with average annual temperatures reaching -27°C in January and as low as +9.4° in July (Kharlamova 2004). At the end of August, the water temperature in the plateau lakes is no higher than 8-9° . The low temperatures do not encourage woody vegetation. The gently-sloping waterlogged plains of the plateau are grassland halophytic steppes as well as lowland bogs with sedge and cottongrass or tundra with sedge and ko-bresia grown on peat and gley soils.

Fig. 1. А — Lake Ukok, B — Lake Kaldzhin-Kul Рис. 1. А — озеро Укок, B — озеро Кальджин-Куль

The Ukok Plateau flora and fauna have been the subject of a range of studies. One of the most comprehensive biogeographical reviews was developed by the research team of

Gorno-Altaisk State University (Bondarenko et al. 2022). The review focuses specifically on birds, fish, mammals, and, partly, invertebrates (insects only). However, the review as

Table 1

Primers used for sample genotyping

Таблица 1

Праймеры, использованные для генотипирования исследуемых образцов

Primer Gene Nucleotide sequence (5'-3') Annealing temperature, °C Reference

1 F 18S-ITS1- TCGGAT TGGTCTCGGTCTG 62.8

1R 5.8S GCGTTCAAGATGTCGATGTTC Prokhorova

2F 5.8S- T TG CAGAACACAT TGAACATCG 64 et al. 2015

2R ITS2-28S GGAGTTTACCACCCGCTTTG

HCO2198 cox1 TAAAC TTCAGGG TGACCAAAA AATCA 54.1 Folmer et al.

LCO1490 G G TCAACAAATCATAAAGATA TTGG 1994

well as other available relevant sources fail to provide any information on molluscs inhabiting the Ukok Plateau water bodies. To fill the gap in the knowledge about the Ukok Plateau malacofauna, two glacial (moraine-dammed) lakes — Ukok and Kaldzhin-Kul — were chosen. It is assumed that they appeared after the degradation of the Late Pleistocene glaciation (Mikhailov 1994). The studied area is marked by earlier Upper Quaternary sediments of sand and clay with larger inclusions.

Material and methods Collection of samples

Lake Ukok is located at 49°15'52" N, 87°22 ' 56" E. Its absolute elevation is 2,416 m. It covers 2.4 sq. km. The maximum dimensions of the lake are 2.5 by 1.2 km. The shore is 8.4 km long. The lake lies in a small depression eroded by the glacier. Its slopes are mainly granite outcrops covered sporadically with shallow ground moraine (Fig. 1: A). The shore is alpine meadow. The Kara-Bulak River flows out of Ukok Lake to soon join the Ak-Alakha River as a drainage basin for all the rivers of the Ukok Plateau. The maximum depth of the lake is 9.6 m, the average depth is 2.5 m. In late summer the water temperature does not exceed 10°C. Its bottom is covered with algae. The samples of molluscs were taken along its left south-western shore (Fig. 1: A).

Lake Kaldzhin-Kul is located at 49°19 ' 24"N, 87°27 ' 29" E. Its absolute elevation is 2,402 m. It covers 3.9 sq. km. The maximum dimen-

sions of the lake are 3.7 by 2.3 km. The shore is 12.2 km long. The shores are low and marshy (Fig. 1: B). An anabranch from Lake Kaldzhin-Kul-Bas located a few metres higher flows into Lake Kaldzhin-Kul. The Kaldzhin River, a left tributary of the Ak-Alakha River, flows out of Kaldzhin-Kul. Molluscs were collected near the source of the Kaldzhin River (Fig. 1: B).

Morphological analysis

The shell structure and the reproductive system of snails were analysed using a Leica M165C stereomicroscope. Photographs were taken using a Leica DFC290 camera.

Molecular genetic analysis

For molecular genetic studies, mollusc tissues were fixed and stored in 90% etha-nol. Before the DNA extraction, the samples were washed in three changes of distilled water. DNA was isolated using a commercial DNA-Sorb-C-M kit (cat. no. K1-6-50-Mod) (AmpliSens, Russia) by following the manufacturer's instructions. Genotyping was performed on an rDNA fragment (18S-ITS1-5.8S-ITS2-28S) and mitochondrial gene fragment of cytochrome c-oxidase subunit I (coxl). See Table 1 for nucleotide sequences of primers and appropriate annealing temperatures.

All the PCR reactions were performed with Taq DNA polymerase (Thermo Scientific) in 20 |il reaction volume of 16 |il sterilized distilled water, 2 |il of Taq10x buffer, 1 |il of DNA (10 ng/|il), 0.4 |il of each primer (10 nM)

Fig. 2. A. agotis shell: A-C — mollusc shell from Lake Ukok; D-F — mollusc shell from Lake Kaldzhin-Kul. Copulative apparatus of A. lagotis molluscs: G — mollusc from Lake Ukok; H — mollusc from Lake Kaldzhin-Kul. Scale bar: A-F — 10 mm, G — 2 mm, F — 1 mm

Рис. 2. Раковина A. lagotis: A-C — раковина моллюска из озера Укок; D-F — раковина моллюска из озера Кальджин-Куль. Копулятивный аппарат моллюсков A. lagotis: G — моллюска из озера Укок; H — моллюска из озера Кальджин-Куль. Масштаб: A-F — 10 мм, G — 2 мм, F — 1 мм

Table 2

Dimensions (in mm) of Ampullaceana lagotis mollusc shells from different collecting sites (average values and standard errors). Statistically significant differences between the samples

are marked with an asterisk

Таблица 2

Размерные характеристики (в мм) раковин моллюсков Ampullaceana lagotis из разных точек сбора. Указаны средние значения и ошибки среднего. Звездочкой отмечены параметры, для которых была выявлена статистически значимая разница между

выборками

Parameter Ukok Lake Kaldzhin-Kul Lake

Number of studied molluscs. In brackets is the number of those which had their prepuce length and penial sac length measured. 11 (3) 15 (3)

Shell height* 23.83±0.72 11.76±0.73

Shell width* 16.63±0.87 8.90±0.40

Aperture height* 16.37±0.58 8.45±0.37

Aperture width* 11.12±0.53 5.63±0.24

Whorl height* 8.18±0.40 3.65±0.37

Height of the last whorl* 21.18±0.70 10.13±0.57

Prepuce length 5.35±0.73 3.13±0.07

Penial sac length 3.59±0.37 2.62±0.22

Index of the copulatory apparatus 1.48±0.07 1.21±0.10

Numbers of ITS1-5,8S-ITS2 fragment sequences annotated in GenBank 0R600215.1, 0R600216.1, 0R600217.1, 0R600218.1, 0R600226.1, 0R600227.1, 0R600228.1, 0R600229.1 0R600208.1, 0R600209.1, 0R600210.1, 0R600211.1, 0R600212.1, 0R600213.1, 0R600214.1, 0R600219.1, 0R600220.1, 0R600221.1, 0R600222.1, 0R600223.1, 0R600224.1, 0R600225.1

Numbers of coxl sequences annotated in GenBank 0R722466.1 0R593313.1

and 0.2 |il (5 U/ |il) of Taq polymerase following the protocol described in (Prokhorova et al. 2020). The electrophoretic analysis of the PCR products was performed in 1.4% agarose gel in TBE buffer. The samples of the obtained PCR products were sequenced using an ABI PRISM 310 sequencer (Applied Biosystems). The assembly and multiple alignment of nucleotide sequences and the analysis of the chromatograms were performed with BioEdit v. 7.2.5 (Hall 1999) and MEGA v. 10.2.4 (Kumar et al. 2018). We also used the BLAST software on the NCBI server to establish the homology of nucleotide sequences (BLAST... 2023).

Phylogenetic reconstructions with the use of the maximum likelihood method were performed with MEGA v. 11 (Kumar

et al. 2018; Tamura et al. 2021). Bayes-ian analysis was performed using BEAST v. 2.5 (Bouckaert et al. 2019) followed by a tree visualisation using TreeAnnotator v. 1.1.4 (Helfrich et al. 2018). An optimal mathematical model for calculating genetic distances was chosen with the help of the Akaike information criterion and Bayesian information criterion with the jModelTest v. 2.1.7 software (Darriba et al. 2012). The phylogenetic reconstructions from rDNA fragments (ITS1-5.8S, ITS2-28S) and a coxl gene fragment was performed using the General Time Reversible model with gamma correction (GTR+G) (Nei, Kumar 2000). Bootstrap branch support (BS) levels for ML and Bayesian analysis were performed with 1,000 replicates (Felsenstein 1985).

»2/0.7

100 Л

4h

9Я1

97/0.99

ORGOQ2154mpuJtace9na lagotis isolate U1 OR600218Ampullaceana lagotis isolate U5 — 0 R6 0 0 216,4 mpullaceana lagotis isolate U3

Q R6Q 0217 d mpullaceana lagotis isolate U4 L 0 R6Q 0212 A mpullaceana lagotis isolate U05 p O R6 0 0210/1 mpullaceana lagotis isolate U03 OR§Q02№Ampultaceana lagotis isolate U02 QR600211 Ampullaceana lagotis isolate U04 OR600214 Ampullaceana lagotis isolate UOS

-QRSQ02MAmpullaceana lagotis isolate UOfi

-HG932024.1 Radix (Ampullaceana) ampia

HG932D31.1 Radix (Ampullaceana) balthica JN614442.1 Radix peregra JN614442.1 Radix peregra — MW248575.1 Radix natalensis -MW248 575.1 Radix auricularia

100/1

100/1

-II-

QJF922878.1 Radix auricularia - ■ JX1935891 Radix auricularia

-MF148308.1 Succ/nea putris

Fig. 3. Phylogenetic reconstruction based on nucleotide sequences of 18S (partial)-ITS1-5.8S (partial) rDNA (690 bp). The number at the branch nodes indicates percentage bootstrap support for 1,000 replicates for ML and posterior probability for BI. The Figure shows the numbers of the used GenBank sequences

Рис. 3. Филогенетическая реконструкция на основании 18S (4ac™4Ho)-ITS1-5.8S (частично) рДНК (690 п. н.). В узлах указаны бутстрепные поддержки для 1000 реплик для ML и значения апостериорных вероятностей для BI. Указаны номера использованных последовательностей в GenBank_

The choice of the outgroups was mainly based on the presence and the completeness of nucleotide sequences of the studied genome regions. The following sequences from GenBank were used to construct the phylogenetic trees: Ampullaceana ampla (HG932024.1, LS974249.1, HG932229.1), A. balthica (HG932031.1, MZ400505.1, MW709280.1, MW675330.1), A. dipkunensis (MH189854.1), A. fontinalis (MH189853.1) A. lagotis (MT708678.1, GU574224.1, AJ319639.1, MH189939.1, MH189995.1), A. zazurnensis (KT852376.1, KF918625.1), Peregriana dol-gini (KT030050.1, MH189979.1), P. labiate (KX056253.1), Radix alticola (LC659114.1), R. auricularia (JF922878.1, JX193589.1, MN194260.1, OP174292.1, MK779205.1), Radix cf. plicatula (LC659144.1), R. euphra-tica (MH189866.1), R. labiate (KX056263.1), R. natalensis (MW248575.1, HQ283270.1, MN737037.1), R. peregra (JN614442.1, HQ283258.1), R. rubiginosa (LC659107.1, KM067685.1), R. rufescens (LC659117.1), Succinea erythrophana (NC069953.1), S. pu-

tris (MF148308.1, MH352216.1), 5. striata (AY841295.1).

Results and discussion Morphological analysis

We studied the shell structure of molluscs from both lakes. As a result, the molluscs were found to belong to the same species — Ampullaceana lagotis Schrank, 1803. The species has a long research history. Over its course, it has been assigned to different genera. Among them are Buccinum, Lymnaea, Radix, and Peregriana, with the majority belonging to the Lymnaeidae family (Vinarski et al. 2020).

The Ampullaceana lagotis shell is ovoid-conical, trochospiral, dexiotropic, evolute (Fig. 2: A-F). Shell walls thin with a clear sculpturing of growth lines. Tangent line convex. Umbilical slit partly covered by a parietal lip of the aperture. Parietal depression strongly impressed. The suture of each whorl deep, oblique. Aperture oval, parietal and palatal angle sharp.

Already at the sample collection stage the Ukok Lake molluscs were found to be visibly

90 M

»6fü.«8

56 Г 0.7

67 / 0.72

M 11

-H-

90/11.96

78/ 0.67

KT 852376.1 Radix (Ampullaceana) zazurnensis OR6ÜÜ229 Ampullaceana lagotis isolate U5 OR600228 Ampullaceana Iagotis isolate U4 ORSQQ227 Ampullaceana Iagotis isolate U3 OR60Ü226 Ampullaceana Iagotis isolate U1 j- GU574224.1 Radix (Ampullaceana) Iagotis Sil MT 70 8678.1 Ampullaceana Iagotis 0.0 AJ319639.1 Radix (Ampullaceana) Iagotis OR6ÜÜ223 Ampullaceana Iagotis isolate U06 OR600219 Ampullaceana Iagotis isolate U01 r OR600220 Ampullaceana Iagotis isolate U02 OR600221 Ampullaceana Iagotis isolate U03 OR600222 Ampullaceana Iagotis isolate U04 OR600224 Ampullaceana Iagotis isolate U06 ORm225 Ampullaceana Iagotis isolate U09 — L£974249.1 Radix (Ampullaceana) ampia "looMi— MZ 40 050 5.1 Ampullaceana balthica ' MVY7 09280.1 Ampullaceana balthica

76 I № 9

9510.32

99 11

100/

KT 030050.1 Peregriana dolgini KXO 56263,1 Radix labia:*

-L С 659117 Radix rufescens

HQ283270.1 Radix natalensis

-L С 669107.1 Radix rubiginosa

ïC.

89/[>.9l|_r

7гм1

L С 659114.1 Radix alticola - OP174292.1 Radix aurícularía

-H-

100/

ït

LC659144.1 Radix cf. plicatula

-AY8 41295.1 Succinea striata

-MF 14830 8.1 Succinea putris

Fig. 4. Phylogenetic reconstruction based on nucleotide sequences of ITS2-28S (partial) rDNA (711 bp). The number at the branch nodes indicates percentage bootstrap support for 1,000 replicates for ML and posterior probability for BI. The Figure shows the numbers of the used GenBank sequences

Рис. 4. Филогенетическая реконструкция на основании ITS2-28S (частично) рДНК (711 п. н.). В узлах указаны бутстрепные поддержки для 1000 реплик для ML и значения апостериорных вероятностей для BI. Указаны номера использованных последовательностей в GenBank_

bigger than those from Lake Kaldzhin-Kul. This observation was supported by shell measurements (Table 2; Fig. 2: A-F).

All the collected samples were found to have the same reproductive system typical of the Ampullaceana genus (Aksenova et al. 2018). The copulatory apparatus includes the prepuce and the penial sac (Fig. 2: G-H). The index of the copulatory apparatus of molluscs varies from 1.08 to 1.70 and does not differ significantly between molluscs from different lakes (Table 2).

Molecular genetic analysis

Genotyping resulted in nucleotide sequences of a 1515-1771 bp long rDNA frag-

ment. It includes the 18S (partial)-ITS1-5.8S-ITS2-28S (partial) sequence and coxl of 656659 bp in length (Table 2).

The obtained sequences were used in phyloge-netic reconstructions of fragments 18S-ITS1-5.8S (Fig. 3), 5.8S-ITS2-28S (Fig. 4) and coxl (Fig. 5).

All the obtained phylogenetic sequence reconstructions of molluscs collected from the Ukok Plateau comprise a single clade and match the Ampullaceana lagotis specimens. However, the same clades based on the reconstruction of ITS2-28S and coxl include Radix zazurnensis sequences — KT852376.1 and KF918625.1, respectively. Later, the authors of these sequences identified the studied isolate as Ampullaceana (Radix) lagotis (Aksenova et al. 2016; 2017).

95/36

93 / 0.72

77/0.72

«10,521 KF91S625.1 Radix ('Ampullaceana) гагигпепзЬ

J- MH189995.1Ampullaceana lagotis JOOM.L MH189939.1 Л mpu/tecMfiaJagorts

г OR593313.1 Ampullaceana lagotis isolate U01 9«/o.«l OR722466.1 Ampullaceana lagotis isolate У1 -MH189853.1 ЛтриЛасмпа fontinalis

64/ 0.59

MW675330.1 Ampullaceana balthica

9Щ1

MH139354.1 Ampullaceana dipkunensis - HG932229.1 Radix (Ampullaceana) ampla

9H O.Wl

99/1

60/0,56

90/0.91

Ю0/1

MH189979.1 Peregriana dolgini KXO 56253,1 Peregriana lab ia:a MK779205.1 Radix auricularia

- MN 737 037.1 Radix natalensis

- M H189866.1 Radix euphratica

- KM 067 6 85.1 Radix rubiginosa

- M H 352216.1 Succinea putris

NC 069953.1 Succinea erythrophana

Fig. 5. Phylogenetic reconstruction based on nucleotide sequences of a fragment of the coxl gene (626 bp). The number at the branch nodes indicates percentage bootstrap support for 1,000 replicates for ML and posterior probability for BI. The Figure shows the numbers of the used GenBank sequences

Рис. 5. Филогенетическая реконструкция на основании фрагмента гена coxl (626 п. н.). В узлах указаны бутстрепные поддержки для 1000 реплик для ML и значения апостериорных вероятностей для BI. Указаны номера использованных последовательностей в GenBank

In addition, phylogenetic reconstruction of the coxl gene of A. lagotis snails from the Ukok Plateau also clusterizes with molluscs from Lake Teletskoye, genotyped as Radix zazurnensis (GenBank KF918624.1).

As stated before, the Ampullaceana lagotis species has developed a few synonyms. Of them, the most frequent in use are Radix lagotis (Schniebs et al. 2015; Gloer 2019) and Lymnaea (Peregriana) lagotis (Kruglov, Staro-bogatov 1983; Khokhutkin et al. 2009). All the given names were used to annotate genome sequences of molluscs in GenBank. For this reason, phylogenetic reconstructions sometimes feature two names of taxa.

The obtained nucleotide sequences and the data from GenBank were used to calculate average intraspecific and interspecific genetic distances for the Ampullaceana genus (Table 3, 4). The samples genotyped by us are unique for Ampullaceana lagotis with respect to the ITS1 fragment. The genetic distance for the fragment

in question between A. lagotis and A. baltica and A. ampla exceeds the distance between the latter two (Table 3). Similar results were obtained for ITS2: A. lagotis differs more from A. baltica and A. ampla than these two species differ from each other. However, the distance between A. lagotis specimens collected on the Ukok Plateau and in other regions does not exceed the average interspecific distance characteristic of the Ampullaceana genus (Table 4).

Thus, the morphological and molecular genetic analyses show that snails collected in the lakes Ukok and Kaldzhin-Kul belong to the same species — Ampullaceana lagotis. At the same time, the intraspecific variability of A. lagotis from water bodies on the Ukok Plateau is higher than the average intraspecific distance between the representatives of this species.

The most variable of the studied genome fragments was ITS2. A. lagotis molluscs from Lake Kaldzhin-Kul have 618 bp long ITS2, which is characteristic of the same species

Table 3

Intraspecific and interspecific genetic distances (p-distance) for Ampullaceana molluscs based

on the ITS1 rDNA fragment

Таблица 3

Внутривидовые и межвидовые генетические дистанции (p-distanoe) для моллюсков рода

Ampullaceana по фрагменту ITS1 рДНК

ITS1 (745-748 bp) Interspecific Intraspecific p-distance

p-distance A. baltica A. ampla

A. lagotis Ukok 0.0191 0.0544 0.0427

A. baltica 0.0037 — 0.0331

A. ampla 0.0019 — —

Average p-distance 0.0162 0.0434

of molluscs from other regions (see above). However, A. lagotis molluscs from Lake Ukok have 21-nucleotide insertion in ITS2. Previously, a similar insertion in ITS2 was found in A. lagotis pond snails from the Irkut River (KT852376.1).

Conclusion

Snails collected in Lake Ukok and Lake Kaldzhin-Kul have shown not only morphological, but also genetic differences. This leads us to suppose that Ampullaceana lagotis molluscs in two different lakes are isolates. In addition, the lack of intrapopulation variability in A. lagotis molluscs may indicate a relatively recent settlement of these snails in the lakes Ukok and Kaldzhin-Kul. This is confirmed by the results of geomorphological analysis. It showed that both lakes appeared after the degradation of the Late Pleistocene glaciation (Mikhailov 1994)

Previously, similar data were obtained in a study on genotypic diversity of Radix spp. on the Tibetan Plateau (von Oheimb et al. 2011). The study of the malacofauna of 46 lakes sug-

gests that molluscs inhabited the water bodies at different times. Some of the studied mollusc populations have existed since before the Last Glacial Maximum. These populations are marked by considerable genotypic diversity. The other lakes were not inhabited until relatively recently. They have more genetically homogeneous populations of molluscs. The hydrobiological analysis of the region concluded that molluscs colonized the water bodies not only through the aquatic system but also through passive dispersal by birds.

Lake Kaldzhin-Kul and Lake Ukok may have been formed by different moraines and, similarly to the Tibetian Plateau water bodies, were inhabited by Ampullaceana lagotis snails at different times. The shallow Ukok is a moraine-dammed lake, while the deep Kaldzhin-Kul occupies a rift lined by dump moraine.

At the same time, despite the proximity of the lakes, the water-based exchange of malaco-fauna between them is complicated. The reason is the high current velocity of the Kara-Bulak and Kaldzhin rivers flowing out of the lakes, as

Table 4

Intraspecific and interspecific genetic distances (p-distance) for Ampullaceana molluscs based

on the ITS2 rDNA fragment

Таблица 4

Внутривидовые и межвидовые генетические дистанции (p-dista^e) для моллюсков рода

Ampullaceana по фрагменту ITS2 рДНК

ITS2 (618-639 bp) Interspecific Intraspecific p-distance

p-distance A. baltica A. ampla A. lagotis

A. baltica 0.0020 — — —

A. ampla 0.0025 0.0176 — —

A. lagotis 0.0080 0.0243 0.0203 —

A. lagotis Ukok 0.0162 — — 0.0132

Average p-distance 0.0071 0.0197

well as the Ak-Alakha river, of which they are tributaries. Local climate also contributes to the isolation of mollusc populations. The activity season for snails, including reproduction, is short, while different temperature dynamics of the two lakes also hinder their dispersal beyond the established habitats. The exchange of the malacofauna between the lakes by birds is also limited due to the hydrobiological specifics.

Acknowledgements The authors would like to thank M. V. Vi-narski for his assistance in the identification of molluscs.

Funding

This research was supported by the Ministry of Education of Russia as part of the state-commissioned assignment No. VRFY-2023-0009.

References

Aksenova, O. V., Bolotov, I. N., Gofarov, M. Yu. et al. (2018) Species richness, molecular taxonomy and biogeography of the radicine pond snails (Gastropoda: Lymnaeidae) in the Old World. Scientific Reports, vol. 8, article 11199. https://doi.org/10.1038/s41598-018-29451-1 (In English) Aksenova, O. V., Vinarski, M. V., Bolotov, I. N. et al. (2016). An overview of Radix species of Kamchatka Peninsula (Gastropoda: Lymnaeidae). The Bulletin of the Russian Far East Malacological Society, vol. 20, no. 2, pp. 5-27. (In English) Aksenova, O. V., Vinarski, M. V., Bolotov, I. N. et al. (2017) Two Radix spp. (Gastropoda: Lymnaeidae) endemic to thermal springs around Lake Baikal represent ecotypes of the widespread Radix auricularia. Journal of Zoological Systematics and Evolutionary Research, vol. 55, no. 4, pp. 298-309. https://doi.org/10.1111/jzs.12174 (In English) BLAST: Basic local alignment search tool (2023) National Library of Medicine. Version 2.15.0.

[Online]. Available at: http://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed 05.04.2024). (In English) Bogachkin, B. M. (1981) Istoriya tektonicheskogo razvitiya Gornogo Altaya v kajnozoe [History of tectonic development of Gorny Altai in the Cenozoic]. Moscow: Nauka Publ., 132 p. (In Russian) Bondarenko, A. V., Malkov, N. P., Maneev, A. G. et al. (2022) Gory snezhnykh barsov. Priroda i biologicheskoe raznoobrazie natsional'nogo parka na yuge Respubliki Altaj [Mountains of snow leopards. Nature and biological diversity of the national park in the south of the Altai Republic]. Biysk: Matritsa Publ., 229 p. (In Russian) Bouckaert, R., Vaughan, T. G., Barido-Sottani, J. et al. (2019) BEAST 2.5: An advanced software platform for Bayesian evolutionary analysis. PLoS Computational Biology, vol. 15, no. 4, article e1006650. https://doi.org/10.1371/journal.pcbi.1006650 (In English) Darriba, D., Taboada, G. L., Doallo, R., Posada, D. (2012) jModelTest 2: More models, new heuristics and parallel computing. Nature Methods, vol. 9, no. 8, p. 772. https://doi.org/10.1038/ nmeth.2109 (In English)

Felsenstein, J. (1985) Confidence limits on phylogenies: An approach using the bootstrap.

Evolution, vol. 39, no. 4, pp. 783-791. https://doi.org/10.2307/2408678 (In English) Gloer, P. (2019) The freshwater gastropods of the West-Palaearctis. Vol. 1. Fresh- and brakish waters except spring and subterranean snails. Identification key, anatomy, ecology, distribution. Hetlingen: Biodiversity Research Lab Publ., 399 p. (In English) Hall, T. A (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program

for Windows 95/98/NT. Nucleic Acids Symposium Series, vol. 41, pp. 95-98. (In English) Helfrich, P., Rieb, E, Abrami, G, Lucking, A, Mehler, A. (2018) TreeAnnotator: Versatile visual annotation of hierarchical text relations. In: N. Calzolari (ed.) Proceedings of the LREC 2018: Eleventh International Conference on Laguage Resources and Evaluation. Miyazaki, Japan: European Language Resources Association, pp. 1958-1963. Kharlamova, N. F. (2004) Klimaticheskie osobennosti ploskogor'ya Ukok i prilegayushchikh territorij [Climatic features of the Ukok plateau and surrounding areas]. Izvestiya Altajskogo gosudarstvennogo universiteta — Izvestiya of Altai State University, no. 3, pp. 71-77. (In Russian) Khokhutkin, I. M., Vinarski, M. V., Grebennikov, M. E. (2009) Mollyuski Urala i prilegayushchikh territorij. Semejstvo Prudovikovye Lymnaeidae (Gastropoda, Pulmonata, Lymnaeiformes). Ch. 1 [Molluscs of the Urals and the adjacent areas. The family Lymnaeidae (Gastropoda, Pulmonata, Lymnaeiformes). P. 1]. Ekaterinburg: Goshchitskiy Publ., 162 p. (In Russian). Kruglov, N. D., Starobogatov, Ya. I. (1983) A contribution to the morphology and taxonomy of European representatives of the subgenus Peregriana (Lymnaea, Gastropoda, Pulmonata). Zoologicheskij zhurnal — Zoological Journal, vol. 62, no. 10, pp. 1462-1473. (In Russian)

Kumar, S., Stecher, G., Li, M. et al. (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, vol. 35, no. 6, pp. 1547-1549. https://doi.org/10.1093/molbev/msy096 (In English) Mikhailov, N. N. (1994) Ozera Altaya, ikh proiskhozhdenie i istoriya [Lakes of Altai, their origin and history]. In: G. Ya. Baryshnikov (ed.). Geografiya i prirodopol'zovanie Sibiri. Vyp. 1 [Geography and environmental management of Siberia. Iss. 1]. Barnaul: Altai State University Publ., pp. 75-89. (In Russian) Nei, M., Kumar, S. (2000) Molecular evolution and phylogenetics. New York: Oxford University

Press, 333 p. https://doi.org/10.1093/oso/9780195135848.001.0001 (In English) Prokhorova, E. E., Usmanova, R. R., Ataev, G. L. (2020) An analysis of morphological and molecular genetic characters for species identification of amber snails Succinea putris (Succineidae). Invertebrate Zoology, vol. 17, no. 1, pp. 1-17. https://doi.org/10.15298/invertzool.17.L01 (In English) Schniebs, K., Georgiev, D., Glöer, P., Hundsdoerfer, A. K. (2015) A molecular genetic evidence of the occurrence of the freshwater snail Radix lagotis (Schrank, 1803) (Gastropoda: Lymnaeidae) in Bulgaria. Ecologica Montenegrina, vol. 3, pp. 29-39. https://doi.org/10.37828/em.2015.3.5 (In English) Tamura, K., Stecher, G., Kumar, S. (2021) MEGA 11: Molecular evolutionary genetics analysis version 11. Molecular Biology and Evolution, vol. 38, no. 7, pp. 3022-3027. https://doi. org/10.1093/molbev/msab120 (In English) Vinarski, M. V., Aksenova, O. V., Bolotov, I. N. (2020) Taxonomic assessment of genetically-delineated species of radicine snails (Mollusca, Gastropoda, Lymnaeidae). Zoosystematics and Evolution, vol. 96, no. 2, pp. 577-608. https://doi.org/10.3897/zse.96.52860 (In English) von Oheimb, P. V, Albrecht, C., Riedel, F. et al. (2011) Freshwater biogeography and limnological evolution of the Tibetan Plateau — insights from a plateau-wide distributed gastropod taxon (Radix spp.). PLoS ONE, vol. 6, no. 10, article e26307. https://doi.org/10.1371/journal. pone.0026307 (In English)

For citation: Ataev, G. L., Usmanova, R. R., Prokhorova, E. E., Glupov, V. V. (2024) A malacological study of the Ukok Plateau lakes. Amurian Zoological Journal, vol. XVI, no. 3, pp. 633-644. https://www.doi.org/10.33910/2686-9519-2024-16-3-633-644

Received 6 May 2024; reviewed 29 May 2024; accepted 10 June 2024.

Для цитирования: Атаев, Г. Л., Усманова, Р. Р., Прохорова, Е. Е., Глупов, В. В. (2024) Малакологическое изучение озер плоскогорья Укок. Амурский зоологический журнал, т. XVI, № 3, с. 633-644. https://www.doi. org/10.33910/2686-9519-2024-16-3-633-644

Получена 6 мая 2024; прошла рецензирование 29 мая 2024; принята 10 июня 2024.